Cas9d10a

We generated
a λ-DNA reagent with only two tags separated by 150 bp to test
the resolution of the dual-pore instrument. We prepared the Cas9D10A
nickase ribonucleoprotein (RNP) by incubating 1 μL of 100 μM
annealed guide RNA and tracer DNA with 1 μL of 10 μM Cas9D10A
(IDT) in NEB 3.1 buffer for 10 min at rt then put on ice until use.
The guide RNA sequences were CATTTTTTTTCGTGAGCAAT
and AATTCAGGATAATGTGCAAT for the 5′
and 3′ cut sites, respectively (Supporting File 2). Both Cas9 RNPs were combined with the λ-DNA
template to a final concentration of 100 nM RNP (each) and 1.56 nM
λ-DNA and incubated at 37 °C for 1 h. The reaction was
purified by phenol/chloroform extraction followed by ethanol precipitation
and resuspended in deionized water. We then installed 60 nt tags at
the nick sites using the methods described in Conjugation
of Oligodeoxynucleotide Tags.

For DNA nicking using the 48 and 162 sgRNA mix (supplementary Tables S1 and S2),1.25 μM of the synthesized sgRNA was first incubated with 125 nM of Cas9 D10A (NEB) in 1× NEBuffer 3.1 (NEB) at 37°C for 15 min to form a sgRNA-Cas9 complex. 300 ng of the DNA sample was then added to the sgRNA–Cas9 complex mixture and incubated at 37°C for 60 min. For DNA nicking with both Cas9 and Nt.BspQI, 2.5 μM gRNA was first incubated with 63 nM of Cas9 D10A in 1X NEBuffer 3.1 at 37°C for 15min. After that, 300 ng of DNA and 5 U of Nt.BspQI (NEB) were added to the sample mixture and incubated at 37°C for 2 h. The nicked DNA samples were then labeled using 5 U Taq DNA Polymerase (NEB), 1× thermopol buffer (NEB), 266 nM free nucleotides mix (dATP, dCTP, dGTP (NEB) and Atto-532-dUTP (Jena Bioscience)) at 72°C for 60 min. The labeled sample was then treated with Proteinase K at 56°C for 30min and 1uM IrysPrep stop solution (BioNano Genomics) was added to the reaction.