Anti snrnp70

Cardiomyocytes were lysed in RIP lysis buffer, following incubation with RIP buffer containing magnetic beads conjugated with anti-EZH2 antibody (Millipore, USA) or negative control IgG. Anti-SNRNP70 (Millipore, USA) was used as positive control for the RIP procedure. The samples were incubated with Proteinase K with shaking to digest the protein and then immunoprecipitated RNA was isolated. The RNA concentration was measured using a NanoDrop (Thermo Scientific) and the RNA quality assessed using a bioanalyser. Furthermore, purified RNA was subjected to real-time PCR to determine the presence of binding targets using respective primers.

RNA immunoprecipitation (RIP) was performed using the Magna RIP TM RNA-Binding Protein Immunoprecipitation Kit (Millipore, Billerica, MA, USA) and BRE (Abcam) antibody according to the manufacturer’s instructions. Briefly, cells were lysed in RIP lysis buffer, then 100 μl of whole cell extract was incubated with RIP buffer containing A + G magnetic beads conjugated with human BRE antibody, normal IgG (Millipore) as a negative control and Anti-snRNP70 as a positive control (Millipore). Samples were incubated with Proteinase K with shaking to digest the protein and then immunoprecipitated RNA was isolated, The coprecipitated RNAs were detected by reverse transcription PCR. The prime for detecting HOTTIP as follow:

Sense, AACGATGTGTGTGTGCCTTGAT;

Antisense, TGGTCCGACAGGGTGAATT.

RNA immunoprecipitation was performed using the EZ-Magna RIP kit (Millipore, Billerica, MA, USA) following the manufacturer’s protocol. CHME3 cells either infected with JEV for 48 h or Mock at 80–90% confluent were scraped off and then lysed in complete RIP lysis buffer, after which 100 μl of whole cell extract was incubated over night with RIP buffer containing magnetic beads conjugated with anti-Ago2 antibody (Millipore, USA) and negative control normal mouse IgG (Millipore, USA). JEV infection was examined in input samples using specific primer set. Anti-SNRNP70 (Millipore, USA) was used as positive control for the RIP procedure. After 18 hours, samples were incubated with Proteinase K with shaking to digest the protein and then subsequently immunoprecipitates RNA was isolated. The RNA concentration was measured using a NanoDrop (Thermo Scientific, USA). Furthermore, using respective miRNA and gene primers, purified RNA was subjected to qRT-PCR analysis to examine the presence of the binding targets in the RISC complex.