Maxwell lev blood dna kit

Four DNA extraction methods were tested in triplicate with 1-liter samples of DW from a composite sample of 30 liters of cold water collected from the Environmental and Water Resources Engineering Building at the University of Michigan (Ann Arbor). The four methods tested included the commercially available FastSpin kit for soil (MP Biomedicals, Solon, OH) and Maxwell LEV Blood DNA kit (Promega, Madison, WI) and two variations of a standard phenol-chloroform method (PC1 and PC2) with a modified version of the universal nucleic acid extraction buffer (35 (link)) (Table 1). The two phenol-chloroform-based methods (PC1 and PC2) differed in surfactant concentration. Details of the procedure are provided in Text S5. DNA extractions with the FastSpin and Maxwell kits were performed as outlined by Haig et al. (50 (link)) and Webster et al. (51 (link)), respectively. The performance of the different extraction procedures was evaluated by qPCRs targeting NTM, Pseudomonas, and total bacteria as described below. Subsequently, DNA was extracted from 15 DW samples collected from homes and one mock community by PC2, the phenol-chloroform-based extraction method with 0.09% SDS and 5 min of bead beating.

Genomic DNA was extracted from the patient’s peripheral blood using the Promega Maxwell LEV Blood DNA Kit (Cat. No AS1290). 100 ng of genomic DNA was amplified using the following primers: F-5′TGGTAAAACACAATCCTTCACG3′, R-5′TTCTTTGGTACCTTTGGATTTGA3′ using standard protocols (Supplementary Table 2). The PCR product was checked on 2% agarose gel to confirm the amplification product. The remaining PCR product was purified using the Qiagen QiAquick PCR cleanup kit (Qiagen USA), and Sanger sequenced (Genewiz USA).