Pabpc1

Manufactured by Merck Group

PABPC1 is a protein-coding gene that provides instructions for producing a protein called polyadenylate-binding protein 1. This protein is involved in various cellular processes, including the regulation of gene expression and the stability of messenger RNA molecules.

Automatically generated - may contain errors

Lab products found in correlation

Plekha7, by Merck Group (1 mentions) Alexa fluor 488 anti rabbit, by Thermo Fisher Scientific (1 mentions) Alexa fluor 594 anti mouse, by Thermo Fisher Scientific (1 mentions) Alexa fluor 594 anti rabbit, by Thermo Fisher Scientific (1 mentions) Hrp anti mouse, by Jackson ImmunoResearch (1 mentions) Gw182, by Santa Cruz Biotechnology (1 mentions) E cadherin, by BD (1 mentions) Rps6 42mer, by Merck Group (1 mentions) Cytochrome c, by BioLegend (1 mentions) Vdac1, by Santa Cruz Biotechnology (1 mentions) Caspase 3, by Cell Signaling Technology (1 mentions) Caspase 9, by Cell Signaling Technology (1 mentions) Pvdf membrane, by Merck Group (1 mentions)

3 protocols using pabpc1

Comprehensive Antibody Characterization Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

The primary antibodies used in the present study were PLEKHA7 (HPA038610; Sigma-Aldrich), p120 (33-9600; Life Technologies), E-cadherin (610182; BD Transduction Labs), Ago2 (ab57113; Abcam), Ago2 (28550002; Novus Biologicals), Ago2 (AP5281; ECM Biosciences), pAgo2 S387 (AP5291; ECM Biosciences), pAgo2 Y393 (AP5311; ECM Biosciences), GW182 (sc-56314 and sc-377006; Santa Cruz Biotechnology), PABPC1 (04-1467), Dicer (SAB4200087; Sigma-Aldrich), Dicer (sc-136979; Santa Cruz Biotechnology), TRBP (ABE623; Millipore), SOX2 (2748; Cell Signaling Technology), JUN (9165; Cell Signaling Technology), MYC (13-2500; Life Technologies), Nezha (SAB4200415; Sigma-Aldrich), and Actin (A2066; Sigma-Aldrich). Working dilutions were 1:50 to 1:500 for immunofluorescence and 1:500 to 1:2,000 for Western blot.
The secondary antibodies used in the present study were HRP anti–mouse (715-035-150; Jackson ImmunoResearch Laboratories), HRP anti–rabbit (711-035-152; Jackson ImmunoResearch Laboratories), Alexa Fluor 488 anti–mouse (A-11029), Alexa Fluor 488 anti–rabbit (A11034; Life Technologies), Alexa Fluor 594 anti–mouse (A-11005; Life Technologies), and Alexa Fluor 594 anti–rabbit (A-11037; Life Technologies). Working dilutions were 1:500 for immunofluorescence and 1:2,000 for Western blot.

Kourtidis A., Necela B., Lin W.H., Lu R., Feathers R.W., Asmann Y.W., Thompson E.A, & Anastasiadis P.Z. (2017). Cadherin complexes recruit mRNAs and RISC to regulate epithelial cell signaling. The Journal of Cell Biology, 216(10), 3073-3085.

+ Open protocol

+ Expand

Biochemical assays with RNA oligonucleotides

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA oligonucleotides used in the biochemical assays contained the following 5′-3′ sequences: A₁₆ (AAAAAAAAAAAAAAAA) (Sigma), U₁₆ (UUUUUUUUUUUUUUUU) (Sigma), RPS6–20mer (CCUCUUUUCCGUGGCGCCUC) (Sigma), RPS6–42mer (CCUCUUUUCCGUGGCGCCUCGGAGGCGUUCAGCUGCUUCAAG) (T7 in vitro transcribed), RPS6 ΔTOP (GUGGCGCCUCGGAGGCGUUCAGCUGCUUCAAG) (T7 in vitro transcribed), PABPC1 (CCCCUUCUCCCCGGCGGUUA) (Sigma), RPL13A (CACUUCUGCCGCCCCU) (IDT).

Lahr R.M., Mack S.M., Héroux A., Blagden S.P., Bousquet-Antonelli C., Deragon J.M, & Berman A.J. (2015). The La-related protein 1-specific domain repurposes HEAT-like repeats to directly bind a 5′TOP sequence. Nucleic Acids Research, 43(16), 8077-8088.

+ Open protocol

+ Expand

Western Blot Analysis of Cellular Proteins

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein samples were resolved by SDS-PAGE and transferred to a PVDF membrane (Millipore). All primary antibodies were used at 1:1000 and secondary antibodies at 1:5000. The following antibodies were used: ACTB (Developmental Studies Hybridoma Bank, #JLA20-c); VDAC1 (Santa Cruz, sc-8828); cytochrome c (Biolegend, 612504); Caspase-3 (Cell Signaling, 9661); DIS3L1 (Abcam, ab89042); DIS3L2 (Novus, NBP1-84740); Caspase-9 (Cell Signaling, 9502); PABPC1 (Sigma, P6246); PNPT1 (Abcam, ab96176); anti-Mouse HRP (GE Healthcare, NA931V); anti-Rabbit HRP (GE Healthcare, NA934V); anti-Goat HRP (Santa Cruz, sc-2020) . Protein bands were visualized using a SuperSignal West Pico chemiluminescence ECL kit (Pierce).

Liu X., Fu R., Pan Y., Meza-Sosa K.F., Zhang Z, & Lieberman J. (2018). PNPT1 Release from Mitochondria during Apoptosis Triggers Decay of Poly(A) RNAs. Cell, 174(1).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!