Lrcherry2

Manufactured by Addgene

LRCherry2.1 is a fluorescent protein that emits red light. It is commonly used as a marker in biological research applications.

Automatically generated - may contain errors

Lab products found in correlation

Blasticidin, by Thermo Fisher Scientific (1 mentions) Lenti sgrna efs gfp, by Addgene (1 mentions) Stbl3 e coli, by Thermo Fisher Scientific (1 mentions) Lenti cas9 grna gfp vector, by Addgene (1 mentions)

3 protocols using lrcherry2

CRISPR-Cas9 Gene Editing in AML Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Cas9-expression vector, lentiCas9-Blast, was a gift from Dr. Feng Zhang at the Broad Institute of Harvard and MIT (Addgene plasmid # 52962). Cas9 protein was introduced to human AML cell lines by lentiviral transduction and selected with 10 µg/mL Blasticidin (Thermo, R21001). The sgRNA-expression vectors, LRG (Lenti_sgRNA_EFS_GFP) (Addgene plasmid # 65656) and LRCherry2.1 (Addgene plasmid # 108099), were gifts from Christopher Vakoc. Cells were transduced with sgRNA lentivirus and sorted for GFP+ cells 48 hours following transduction (except for negative-selection competition assay). CRISPR sgRNA sequences used were:
sgKAT6A-1: CATACCACTGTTGCCACAGT; sgKAT6A-2: TTCGAGTGAAGGCCTTACGG;
sgKAT6A-3: CTCATCTCCTGTGCCGACTG; sgKAT6A-4: TTAGTGTTGAGCCGATAAAG;
sgKat6a-1: TGCAGCTCCTGTCGTGACCA; sgKat6a-2: GCTATTGCCGCAGTCCGCGC;
sgKat6a-3: CTCGTCTCCTGCGCGGACTG; sgKat6a-4: CGGCGCTATGCTAATCCAAT;
sgKat6a-5: TATGTCAGATATGCCGACCT; sgKat6a-6: CTCAATGCACTGCCACCGTA;
sgRosa26: GAAGATGGGCGGGAGTCTTC; sgNonTarget: ATTGAGAATTCGTTTCAAGG.
Except for the negative selection competition assay which used all the sgRNAs, in other assays: human sgKAT6A-2 and mouse sgKat6a-6 were used, if not indicated otherwise.

Yan F., Li J., Milosevic J., Petroni R., Liu S., Shi Z., Yuan S., Reynaga J.M., Qi Y., Rico J., Yu S., Liu Y., Rokudai S., Palmisiano N., Meyer S.E., Sung P.J., Wan L., Lan F., Garcia B.A., Stanger B.Z., Sykes D.B, & Andrés Blanco M. (2022). KAT6A and ENL form an epigenetic transcriptional control module to drive critical leukemogenic gene expression programs. Cancer discovery, 12(3), 792-811.

+ Open protocol

+ Expand

CRISPR Plasmid Generation for Experiments

Check if the same lab product or an alternative is used in the 5 most similar protocols

Guide RNAs for CRISPR experiments were designed with Benchling (www.benchling.com). Guides were cloned into the Lenti-Cas9-gRNA-GFP vector (Addgene #124770) or LRCherry2.1 (Addgene #108099) using a BsmBI digestion as previously described^{96 (link)}. Plasmids were transformed in Stbl3 E. coli (Thermo Fisher Scientific, cat. no. C737303) and sequence-verified to confirm the presence of the correct gRNA. CRISPR gRNA sequences are listed in Table S5A.

Girish V., Lakhani A.A., Scaduto C.M., Thompson S.L., Brown L.M., Hagenson R.A., Sausville E.L., Mendelson B.E., Lukow D.A., Yuan M.L., Kandikuppa P.K., Stevens E.C., Lee S.N., Salovska B., Li W., Smith J.C., Taylor A.M., Martienssen R.A., Liu Y., Sun R, & Sheltzer J.M. (2023). Oncogene-like addiction to aneuploidy in human cancers. bioRxiv.

+ Open protocol

+ Expand

Generation of GFP and CD19-KO Reh Cell Lines

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

GFP expressing and CD19-KO mCherry expressing Reh B-ALL cell lines were generated following the protocol described in our previous study [29 (link)]. In brief, Cas9-expressing Reh cell lines were first generated by transduction with retroviral Cas9-2A-blast (Addgene, plasmid no. 73310) and then lentivirally transduced with sgRNAs where control sgROSA (Rosa26: AACGGCTCCACCACGCTCGG) cloned into LRG2.1 (Addgene, plasmid no. 108098) and sgCD19 (CD19_GUIDES_sg459: CCTCATGATTGGGTCCAGGC) into LRCherry2.1 (Addgene, plasmid no. 108099). Following the transfection, mCherry⁺ Reh cells were sorted to generate CD19-KO mCherry expressing Reh cell line and GFP⁺ Reh cells to generated GFP expressing Reh cell line using the SY3200 highly automated parallel sorting (HAPS) cell sorter (Sony). CD19-KO mCherry expressing Reh clone was verified by immunoblots for CD19⁻ before banking for subsequent studies.

Ma C., Wang H., Liu L., Tong J., Witkowski M.T., Aifantis I., Ghassemi S, & Chen W. (2023). A bioengineered immunocompetent human leukemia chip for preclinical screening of CAR T cell immunotherapy. Research Square.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!