Reverse transcription polymerase chain reaction (RT-PCR) analyses of the lagBSH gene were performed as follows. Strain JCM1131T was cultured on MRS broth with or without TCA and TDCA at final concentration of 0.05%. The total RNA samples were isolated using the RNeasy Mini Kit (Qiagen, Germantown, MD, USA), and the resulting RNA samples were treated with TURBO™ DNase (Thermo Fisher Scientific, Waltham, MA, USA) to remove contaminated genomic DNA. The presence of chromosomal genomic DNA was confirmed by PCR analysis with the 16S rRNA gene universal PCR primers 530F and 907R using each RNA samples as template. Reverse transcription reactions were performed using SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific) in a 25 μL reaction volume according to the manufacturer’s instruction. The synthesized cDNA samples were used as the PCR template with the following two PCR primer sets: lagBSH-Aset (5’-TCACACCACGCAACTATCCTC-3’ and 5’-GTTGCCAAGGTTAGTAAGATGCC-3’, amplicon size: 467 bp) and lagBSH-Bset (5’-TTAGCTTCTTACGAAATTATGC-3’ and 5’-GAATGCTATCACCTGGTAAAC-3’, amplicon size: 376 bp). The PCR products were analyzed using agarose gel electrophoresis in 2.0% agarose and were stained with Gelred (Fujifilm Wako Pure Chemical Corporation).
Gelred
Manufactured by Fujifilm
Sourced in Japan
GelRed is a nucleic acid stain used for detecting DNA and RNA in agarose gels. It is a sensitive and versatile dye that can be used in various applications such as electrophoresis, DNA visualization, and gel imaging.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (2 mentions)
Superscript 4 reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Turbo dnase, by Thermo Fisher Scientific (1 mentions)
Onestep rt pcr kit, by Qiagen (1 mentions)
High pure viral nucleic acid kit, by Roche (1 mentions)
Chemidoc touch imaging system, by Bio-Rad (1 mentions)
Primescript rt reagent kit with gdna eraser, by Takara Bio (1 mentions)
Trizol solution, by Thermo Fisher Scientific (1 mentions)
Veriti, by Thermo Fisher Scientific (1 mentions)
Premix ex taq, by Takara Bio (1 mentions)
Ultrapure dnase rnase free distilled water, by Thermo Fisher Scientific (1 mentions)
Gel documentation system, by Bio-Rad (1 mentions)
Restriction enzyme, by New England Biolabs (1 mentions)
Dna ligation kit, by Takara Bio (1 mentions)
Kanamycin, by Fujifilm (1 mentions)
Lb agar, by Merck Group (1 mentions)
Mighty ta cloning kit, by Takara Bio (1 mentions)
Agarose s, by Nippon Gene (1 mentions)
Ampicillin, by Fujifilm (1 mentions)
Agarose 1, by Dojindo Laboratories (1 mentions)
10 protocols using gelred
1
Transcriptional Analysis of lagBSH Gene in Bile Tolerant Bacteria
2
Efficient Detection of Bovine Ephemeral Fever Virus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Viral RNA was extracted from the blood cells with the High Pure Viral Nucleic Acid Kit (Roche, Mannheim, Germany) per the manufacturer’s instructions. For sensitive detection of the partial G gene of BEFV, reverse transcription
polymerase chain reaction (RT-PCR) was conducted with the primer pair BEFV-AO-F (5′ GAATCATTATGGGATCGGATC 3′; at position 1140–1160)/BEFV-AO-R (5′ CCAACCTACAACAGCAGATAAAAC 3′; at position 1587–1564) using the OneStep RT-PCR Kit
(QIAGEN, Hilden, Germany) under the conditions described previously [13 (link)]. The RT-PCR products which are expectedly 448 nucleotide (nt) in length were electrophoresed in 1.5% agarose and
Tris-borate-EDTA (TBE) gel. The gels were stained with GelRed (Wako Pure Chemical Industries) and visualized with ultraviolet (UV) light. The primer pair gpF1 (5′-ATGTTCAAGGTCCTAATAATTACC-3′; at position 1–24)/gpR1872
(5′-TTAATGATCAAAGAATCTATC-3′: at position 1852–1872) [18 (link)] was used for amplification of the full-length BEFV G gene (1,872 nt in length). RT-PCR was performed with the PrimeScript™ One Step
RT-PCR Kit Ver. 2 (TAKARA BIO, Kusatsu, Japan) under the following conditions: 1 cycle at 50°C for 30 min; 1 cycle at 94°C for 2 min; 45 cycles of 94°C for 30 sec, 55°C for 30 sec and 72°C for 2 min; and then maintenance at 4°C.
The RT-PCR product of the expected size was identified by agarose gel electrophoresis.
polymerase chain reaction (RT-PCR) was conducted with the primer pair BEFV-AO-F (5′ GAATCATTATGGGATCGGATC 3′; at position 1140–1160)/BEFV-AO-R (5′ CCAACCTACAACAGCAGATAAAAC 3′; at position 1587–1564) using the OneStep RT-PCR Kit
(QIAGEN, Hilden, Germany) under the conditions described previously [13 (link)]. The RT-PCR products which are expectedly 448 nucleotide (nt) in length were electrophoresed in 1.5% agarose and
Tris-borate-EDTA (TBE) gel. The gels were stained with GelRed (Wako Pure Chemical Industries) and visualized with ultraviolet (UV) light. The primer pair gpF1 (5′-ATGTTCAAGGTCCTAATAATTACC-3′; at position 1–24)/gpR1872
(5′-TTAATGATCAAAGAATCTATC-3′: at position 1852–1872) [18 (link)] was used for amplification of the full-length BEFV G gene (1,872 nt in length). RT-PCR was performed with the PrimeScript™ One Step
RT-PCR Kit Ver. 2 (TAKARA BIO, Kusatsu, Japan) under the following conditions: 1 cycle at 50°C for 30 min; 1 cycle at 94°C for 2 min; 45 cycles of 94°C for 30 sec, 55°C for 30 sec and 72°C for 2 min; and then maintenance at 4°C.
The RT-PCR product of the expected size was identified by agarose gel electrophoresis.
3
Validating Double-Stranded HDO Formation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 3
Experiments were conducted to confirm that the double-stranded agent HDO used in Examples 1 and 2 actually formed a double strand.
The single-stranded ASO and the double-stranded agents HDO used in Examples 1 and 2 were electrophoresed (100 V, 60 min) in a Tris-borate-EDTA buffer using a 15% acrylamide native gel. The gel was stained with GelRed (Wako Pure Chemical Industries, Ltd.), and detection was performed under UV light using a ChemiDoc Touch imaging system (Bio-Rad Laboratories, Inc.).
The results of Example 3 are shown in
4
DNA-HU Binding Assay Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Chemically synthesized oligo DNAs were incubated with various concentrations of TtHU in 20 mM Tris–HCl (pH 7.5) and 100 mM KCl at 37 °C for 1 h. The mixtures were loaded onto a polyacrylamide gel and electrophoresed in TBE buffer (pH 8.2, 89 mM Tris-borate and 2 mM EDTA). The bands were visualized with GelRed (Wako) and UV irradiation.
5
Developmental RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from tissue samples of A. digitifera at different life stages (unfertilized eggs, fertilized eggs, zygotes after 15 h after fertilization, zygotes after 40 h after fertilization, planula larvae, primary polyps, and adult branches) with TRIzol solution (Invitrogen), and the isolated RNA samples (900 ng) were reverse-transcribed to cDNA using the PrimeScript RT reagent kit with gDNA Eraser (Takara). RT-PCR was conducted as follows: denaturation at 94 °C for 1 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 2 min, with a final extension step at 72 °C for 5 min. The reactions were performed in a thermal cycler (Veriti; Applied Biosystems, Foster City, CA, USA) and each 10-µL reaction mixture contained 1 µL of each primer at 5 µM, 1 µL of template cDNA, 2 µL of UltraPure DNase/RNase Free-distilled water (Thermo Fisher Scientific, Waltham, MA, USA), and 5 µL of Premix Ex Taq (TaKaRa, Shiga, Japan). Then, 4 µL of each PCR product was subjected to 2% agarose gel electrophoresis to confirm amplification as a single band visualized with GelRed (Wako, Osaka, Japan) under ultraviolet light.
6
Micrococcal Nuclease Digestion Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MNase assay was performed by the addition of Micrococcal Nuclease (Bio-Rad Laboratories) and MNase buffer (20 mM Tris-HCl (pH 8.0), 5 mM NaCl, 2.5 mM CaCl2) to 28.0 μl of total reaction mixture followed by 5, 10, 20, 30, 40 min incubation at 25 °C. The final concentration of MNase for Drosophila chromatin was 14 U/μl and for human chromatin was 10 U/μl. For the DmH1-containing chromatin, 13 U/μl MNase was used. The assay was halted by EGTA, and proteins were eliminated by phenol-chloroform-IAA extraction followed by ethanol precipitation. The purified DNA was resuspended in HD Buffer (25 mM HEPES, 1 mM DTT, pH 7.6) containing a trace amount of Ribonuclease A and analyzed by 2.0% TAE agarose gel in 1x TAE buffer. Gels containing Drosophila DNA were stained with GelRed (Wako Pure Chemical Corporation) and human DNA was stained with ethidium bromide. The average mononucleosomal DNA length measurement was performed by the gel documentation system (Bio-Rad Laboratories).
7
Detailed Inhibition Assay Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
FQs, CIP, LVX, and MOX that were used in inhibition assays were purchased from LKT Laboratories, Inc. (St. Paul, MN, USA). Kanamycin and ampicillin were purchased from Fujifilm Wako Pure Chemical Co., Ltd. (Osaka, Japan). Restriction enzymes and lambda DNA-HindIII DNA marker were obtained from New England Biolabs, Inc. (Ipswich, MA). DNA ligation kit, Mighty Mix, and Mighty TA cloning kit were purchased from TaKaRa Bio Inc. (Shiga, Japan). Relaxed pBR322 DNA was purchased from John Innes Enterprises Ltd. (Norwich, United Kingdom). Luria-Bertani (LB) broth (Lennox) and LB agar were purchased from Sigma (St. Louis, MO, USA). Agarose S was purchased from Nippon Gene (Toyoma, Japan). Agarose I was obtained from Dojindo (Kumamoto, Japan). Gel red was obtained from Fujifilm Wako Pure Chemical Co., Ltd. (Osaka, Japan).
8
Splicing assay of TREM2 minigenes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A splicing assay was performed as previously described42 (link),43 (link). Cells were cultured in 12-well plates and transfected with 0.5 μg of plasmids for U1/U7 snRNA expression (or cognate empty vector) and 0.05 μg of plasmid to express the minigene. Total RNA was purified using a NucleoSpin RNA kit (Takara Bio, Inc., Shiga, Japan) including DNase treatment. Total RNA (0.5 μg) was subjected to reverse-transcription using Revertra Ace -α- (Toyobo) with a 1:1 mixture of oligo dT and random hexamers as a primer. RT-PCR was performed using Blend Taq –plus- (Toyobo) and a panel of Fw and Rv primer sets as follows: EGFP-C1-Fw and TREM2-ex4-Rv for WT(ex2-4) and NHD(ex2-4) minigenes; TREM2-ex2-Fw2 and RT-TREM2-ex4-Rv for fl-WT and fl-NHD minigenes. PCR products were resolved by electrophoresis on 2% agarose gels or e-PAGEL polyacrylamide gels (ATTO, Tokyo, Japan) and the gels were stained with ethidium bromide (Genesee Scientific Corporation, San Diego, CA, USA) or GelRed (Wako). By sampling at multiple cycles, the cycle numbers of PCR were adjusted such that the amplification was within a logarithmic phase. The gel images were captured by either a digital camera (FAS-digi, Nippon Genetics, Tokyo, Japan) or CCD camera (WSE-6200H LuminoGraph II, ATTO). Multigauge software (FUJIFILM, Tokyo, Japan) was used to quantify the splicing patterns.
9
ITS1 Amplification for Helicoverpa Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to confirm the extraction of genomic DNA, part of the internal transcribed spacer 1 of the ribosomal gene (ITS1) was amplified using a universal primer set for Helicoverpa spp. (Perera et al. 2015 (link)) with partial modification of the reverse primer (Table 2 ).
PCR was performed in a total of 20 μl reaction volume and contained 2 μl of 10× Ex Taq buffer, 200 μM dNTP Mixture, 0.5 U Takara Ex Taq HS (Takara Bio Inc., Shiga, Japan), 0.5 μM each primer, and 1 μl of the template DNA. DNA extracts diluted 100-fold were used as the template DNA. The PCR protocol had following condition: 1 cycle at 94°C for 4 min; 30 or 35 cycles at 94, 65, and 72°C for 30 s each; and at 72°C for 5 min as a final extension. The PCR products were separated by 2% agarose gel electrophoresis containing 0.01% GelRed (Wako Pure Chemical Industries, Ltd., Osaka, Japan), and a 100-bp DNA ladder (Takara Bio Inc.) was used for molecular size estimating.
PCR was performed in a total of 20 μl reaction volume and contained 2 μl of 10× Ex Taq buffer, 200 μM dNTP Mixture, 0.5 U Takara Ex Taq HS (Takara Bio Inc., Shiga, Japan), 0.5 μM each primer, and 1 μl of the template DNA. DNA extracts diluted 100-fold were used as the template DNA. The PCR protocol had following condition: 1 cycle at 94°C for 4 min; 30 or 35 cycles at 94, 65, and 72°C for 30 s each; and at 72°C for 5 min as a final extension. The PCR products were separated by 2% agarose gel electrophoresis containing 0.01% GelRed (Wako Pure Chemical Industries, Ltd., Osaka, Japan), and a 100-bp DNA ladder (Takara Bio Inc.) was used for molecular size estimating.
10
Transcription Analysis of lpBSH Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Reverse transcription-polymerase chain reaction (RT-PCR) analyses of the lpBSH gene were performed as follows. Total RNA samples were isolated using the RNeasy Mini Kit (Qiagen, Germantown, MD, United States) from a full-grown culture of strain JCM 5343T cultured in MRS broth with or without TDCA (final concentration of 0.05%) and cephalosporin C (final concentration of 10 μg/ml). To remove contaminating genomic DNA, the resulting RNA samples were treated with deoxyribonuclease (RT Grade) for Heat Stop (Nippon Gene Co., Ltd., Tokyo, Japan). The absence of contamination due to chromosomal genomic DNA was confirmed by PCR analysis using the 16S rRNA gene universal PCR primers 530F and 907R with each RNA sample as a template. According to the manufacturer’s instructions, reverse transcription reactions were performed using SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA, United States). The synthesized complementary DNA (cDNA) samples were used as the PCR template with the following PCR primer sets: 5′-GTCGAGGTTTCAAAGCAATACGG-3′ and 5′-GCAGAATAGCAAGCAGTATAGACAG-3′, amplicon size: 388 bp. The PCR products were analyzed by 2% agarose gel electrophoresis and stained with GelRed (FUJIFILM Wako Pure Chemical Corporation).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!