Sybr green pcr mater mix

RNA was extracted from whole-cell lystates with a RNeasy Mini kit (Qiagen) and was reverse transcribed with a First Strand cDNA synthesis kit (Fermentas). Quantitative real-time PCR was performed in triplicate with SYBR Green PCR Mater Mix and Applied Biosystems 7500 Real-time PCR Instrument (Life Technologies) using gene-specific primers. Relative expression was normalized to the levels of glyceraldehyde-3-phosphate dehydrogenase (GADPH).

Total RNA was extracted from splenocytes and the tissue of each organ using Trizol (Thermo Fisher Scientific Korea, Seoul). The cDNA of the RNA was synthesized using a commercial cDNA synthesis kit (Thermo Fisher Scientific Korea, Seoul) according to the manufacturer's instructions. Real time PCR was performed using SYBR Green PCR mater mix (Applied Biosystems, Carlsbad, CA, USA) and the following primer sequences: Tβ4-forward 5′-CTC GGC TCC TTC CAG CAA C-3′, Tβ4-reverse 5′-TCG CCA GCT TGC TTC TCT TG-3′, 18S-forward 5′-GTA ACC CGT TGA ACC CCA TT-3′, and 18S-reverse 5′-CCA TCC AAT CGG TAG TAG CG -3′.

Fibroblasts (5 × 10⁴/well) were plated on lower chambers of 12-well transwell plate (0.4 μm pore size). After 6 h of incubation, 5 ng/mL of recombinant human TFG-β1 was treated for 48 h at the presence or absence of TMSCs (5 × 10⁴/well) in upper chambers. The fibroblasts were subsequently subjected to immonofluorescent staining for α-SMA (Abcam) or RNA isolation using TRIzol Reagent (Invitrogen). The number of cells expressing α-SMA was determined from 10 fields of each image. Quantitative real-time-PCR (qRT-PCR) was performed by mixing cDNA synthesized from isolated RNA with primers and SYBR Green PCR Mater Mix (Applied Biosystems, Foster City, CA) using an Real-time-PCR system (ABI7500, Applied Biosystems). The primer sequences used were as follows; α-SMA, GCTACTCCTTCGTGACCACAG (forward) and GCCGTCGCCATCTCGTTCT (reverse); Collagen I, CCTCAAGAGAAGGCTCACGATGGTG (forward) and AGGTCTCACCAGTCTCCATGTTGCA (reverse); Collagen III, GCTCTGCTTCATCCCACTATTA (forward) and TGCGAGTCCTCCTACTGCTAC (reverse); TGF-β1, AGTTGTGCGGCAGTGGTTGA (forward) and GCCATGAATGGTGGCCAGGT (reverse); TGF-β2, TAGACATGCCGCCCTTCTTCC (forward) and AGCACCTGGGACTGTCTGGA (reverse); TGF-β3, AGCACCTGGGACTGTCTGGA (forward) and CAATGTAGAGGGGGCGCACA (reverse).

Total RNA was extracted from cells transfected with CCL7 or GFP (RNAprep Mini kit, Qiagen, Venlo, Netherlands) and 500 ng of RNA was subjected to reverse transcription using MuLV reverse transcriptase (NEB, UK). Real-time quantitative PCR amplification was performed with two-step TaqMan Probe Master Mix (Roche, Indianapolis, IN, USA) or SYBR green PCR Mater Mix (Applied Biosystems, Carlsbad, CA, USA) on an ABI real-time thermocycler (Applied Biosystems, Carlsbad, CA, USA). Human-specific TaqMan PCR primer set were purchased from Applied Biosystems. CCL7 Hs00171147_m1 and β-actin Hs01060665_g1 were used in this study. The following genes were evaluated: CCL7 gene (upstream primer: 5′-accaccagtagccactgtcc -3′; downstream primer: 5′- gaggagcatcccacagtttt - 3′); CCR3 gene (upstream primer: 5′- gacctgctcttcctcgtcac-3′, downstream primer: 5′- agcagagggagaacgagaca-3′); E-cadherin gene (upstream primer: 5′-ggtcgacaaaggacagccta-3′, downstream primer: 5′- ggcgtagaccaagaaatgga-3′); vimentin gene (upstream primer: 5′- ctcctccccctgtcacatac-3′, downstream primer: 5′-tgattggcatcaggaccgtt-3′); Gapdh gene (upstream primer: 5′-aatcccatcaccatcttcca- 3′, downstream primer: 5′-tggactccacgacgtactca-3′). The mRNA level of each gene was quantified using the ΔΔCt method and normalized to that of β-actin.