Pcag egfp

Plasmids encoding fluorescent reporter proteins were used to validate electroporation: pCAG‐DsRed (Addgene: 11151), pCAG‐YFP (Addgene: 11180), pCAG‐EGFP (Addgene: 11150), pCAG‐CFP (Addgene: 11179), pCBA‐TdTomato (Addgene: 28017). Plasmids were amplified and purified according to the suppliers’ recommendations, filtered, and stored at −20°C until use.

R-stage animals were electroporated in the spinal cord as descried before [40 (link)]. Briefly, animals were anesthetized in 0.02% MS222, and the plasmid pCAG:EGFP at 2,5 μg/μl (Addgene plasmid # 16664) or zGFAP::EGFP construct at 2,5 μg/μl (Addgene plasmid # 39761) was injected with a glass capillary into the central canal of the spinal cord. Voltage pulses were applied with a Grass SD9 stimulator (GrassTele-factor, USA) across the back using homemade platinum electrodes (5 pulses of 35 V in each polarity, 50 ms pulse length and 200 pps frequency). Animals were transferred into 0.1x Barth containing antibiotics. Screening of EGFP was perform 24 h after electroporation.

KO was performed as recently described¹⁸, ²⁵, ³³ using pX330 and pCAG‐EGxxFP³⁴ purchased from Addgene. In CRISPR/Cas9‐based gene disruption, guide (g) RNA sequences (5’‐AGCTGTGGCAGCGTCAACAG‐3′) corresponding to the MET gene (394–413 bp from the initiation ATG site), (5’‐GAGGGCGAACGACGCTCTGC‐3′) HER3 gene (3–22 bp from the initiation ATG site), and FOXM1(5’‐CCGTCGGCCACTGATTCTCA‐3′) gene (15–33 bp from the initiation ATG site) were designed using CRISPR direct (https://crispr.dbcls.jp/). SW1116 cells were used to generate HER3 and/or MET and the FOXM1‐KO cell line using the pX330 (Addgene) and pCAG‐EG × ×FP (Addgene) CRISPR/Cas9 vectors. The gene‐specific region of gRNA sequences was designed by the CRISPR design tool from CRISPR direct (https:/crispr.dbcls.jp/). Single clones were picked up and the KO efficiency was assessed by WB and FCM. Cells were seeded onto 35‐mm dishes (BD BioCoat, Franklin Lakes, NJ, USA) in 1 mL of RD medium, and plasmid DNA (5 μg) was introduced into cells of approximately 80% confluency using Xfect transfection reagent (Takara Bio Inc.). The co‐transfection of pX330 and pUC19 (#3219, Takara Bio) containing the puromycin‐resistant gene was also performed, and cells were cultured with puromycin (Invitrogen, 2 μg/mL) for 10 days.

pCAG-EGFP or pCX-HO1-2A-EGFP (Addgene, #74672) were transfected using a standard Lipofectamine 2000 protocol. SH-SY5Y cells were seeded with 2 × 10⁵ cells/mL and incubated for overnight for transfection. Plasmid/Lipofectamine 2000 mixture ratio of 0.8 μg DNA: 1.0 μL lipofectamine 2000 in Opti-MEM were added into the cells which were changed to serum-free media. Cultured for 6 hours and the media were refreshed to the media with 5% FBS and refreshed again to the media with 10% FBS after 18 h. The cells were passaged for amplification at 24-h post-transfection if needed. To rule out the interference from non-transfected cells and get viable transfected cells for corresponding experiments, DAPI-negative and GFP-positive cells were sorted with BD influx cell sorter (MSU Flow Cytometry Core Facility).