Rna extraction solution

Total RNA was extracted from the liver tissue using RNA extraction solution (Servicebio, Wuhan, China) according to the manufacturer’s instructions. The PCR primer sequences are listed in Table 1. Total RNA (10 µl) was reverse transcribed into cDNA. The PCR reactions (20 µl) included the following reagents: 2 µl cDNA, 1.5 µl of 2.5 µM primers, 7.5 µl of 2 × qPCR Mix, and 4 µl Water Nuclease-Free. The RT-PCR reaction steps were as follows: pre-denaturation at 95°C for 30 s, denaturation at 95°C for 15 s, and annealing at 60°C for 30 s, cycling 40 times. The melting curve was 65–95°C, and the fluorescence signal was recorded once for each increase of 0.5°C. The expression of the mRNAs of α-smooth muscle actin (α-SMA), prostaglandin G/H synthase 2 (COX2), formyl-peptide receptor-2 (FPR2), prostaglandin G/H synthase 1(PTGS1), nuclear receptor coactivator 2 (NCOA2), IL-1β, tumor necrosis factor-α (TNF-α), chemokine [CXC motif] ligand 4 (CXCL14), and transforming growth factor-β1 (TGF-β1), relative to the control gene GAPDH mRNAs, was detected using the 2^−ΔΔCT method.

Three appropriate amounts of tissue were taken from each group, and total RNA was extracted using RNA extraction solution (Servicebio, Wuhan, China) according to the manufacturer's instructions, and the RNA concentration was detected with Nanodrop 2,000 (Thermos); a bio reverse transcription kit (Servicebio, Wuhan, China) was used, and a reaction system was set up for RNA reverse transcription to synthesize cRNA. Subsequently, polymerase chain reaction (PCR) amplification was performed with the following amplification conditions: pre denaturation at 95°C for 10 min; 95°C for 15 s, 60°C for 60 s, 40 cycles; 75–95°C with 1°C ramp every 20 s. GAPDH was used as internal reference and the primers were obtained from Wuhan Google Biotechnology Co, Ltd, and the primer sequences are shown in Supplementary Table 1. Relative gene expression was calculated using the double standard curve method. Three independent experiments were repeated.

Total RNA was extracted using an RNA extraction solution (Servicebio, Wuhan, China). Reverse transcription was performed using a Servicebio^®RT First Strand cDNA Synthesis kit (Servicebio), followed by PCR reactions with 2 × SYBR Green qPCR Master Mix (Servicebio). GAPDH was used as an internal control for mRNA. The 2^−ΔΔCT method was used for relative quantification. The primers (5′–3′) used for gene amplification are listed in Table 1.Table 1

The primers (5′–3′) used in this study

Primers	Forward	Reverse
ZMIZ2	CCTGGCTGTAAGCAACCATGTC	GCCAGTTGGTGTTCATCTGCCG
MCM3	CGAGACCTAGAAAATGGCAGCC	GCAGTGCAAAGCACATACCGCA
CCL5	CCTGCTGCTTTGCCTACATTGC	ACACACTTGGCGGTTCTTTCGG
E2F4	GGAAGGTATCGGGCTAATCGAG	AGCTCCTCGATCTCTGCCTTGA
DHX38	GACCTGGATCACTACAGTGCCA	GTGGCTGATGTGACGATGAGCT
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG