Log In Sign up
The largest database of trusted experimental protocols

Plenti cas9 puro

Manufactured by Addgene
Visit Supplier

The PLenti-Cas9-Puro is a lentiviral vector that expresses a puromycin resistance gene and the Cas9 endonuclease, which is commonly used for CRISPR-Cas9 genome editing applications.

Automatically generated - may contain errors

Lab products found in correlation

Sc 420579, by Santa Cruz Biotechnology (2 mentions) Plenticrisprv2, by Addgene (2 mentions)

Close spelling variants of this product

PLenti-puro (24 citations)

2 protocols using plenti cas9 puro

1

Modulating GLUL, IDH2, and DLST expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Expression: mouse GLUL expression cDNA was cloned into pLPC retroviral vector. Short-hairpin RNA (shRNA): pLKO-based shRNA plasmids were purchased from Sigma-Aldrich
Mouse GLUL shRNA (NM_008131, #1: TRCN0000309816; #2: TRCN0000309745). Human IDH2 shRNA (SHCLNG-NM_002168, #1: TRCN0000229434; #2: TRCN0000229778). The following sequencesagainst DLST werecloned into pLKO.1 plasmid: shDLST#1: TGTCTCATAGCCTCGAATATC; shDLST#2: CGAAAGAATGAACTTGCCATT. CRISPR/Cas9 short guide RNA (sgRNA): for the organoid study, sgRNAs were cloned into the LRNG vector (pLenti-sgRNA-EFS-Neo-IRES-GFP) (Roe et al., 2017 (link)). Control sgRNA: sgRosa26 GAAGATGGGCGGGAGTCTTC; for mouse GLUL silencing, sgGLUL#1: TGGGATCGTAGGCGCGAATG; sgGLUL#2 CATTCGCGCCTACGATCCCA. pLenti-Cas9-Puro (Addgene #108100) was used for the expression of spCas9. For human cell culture, sgRNA of human GLUL was cloned into pLentiCRISPRv2 (Addgene #52961). sgGLUL: GCGCTGCAAGACCCGGACCC. For mouse cell culture and orthotopic studies, a pool of three plasmids each containing a 20 nt guide RNA sequence specific to mouse GLUL was purchased from Santa Cruz Biotechnologies (sc-420579).
Bott A.J., Shen J., Tonelli C., Zhan L., Sivaram N., Jiang Y.P., Yu X., Bhatt V., Chiles E., Zhong H., Maimouni S., Dai W., Velasquez S., Pan J.A., Muthalagu N., Morton J., Anthony T.G., Feng H., Lamers W.H., Murphy D.J., Guo J.Y., Jin J., Crawford H.C., Zhang L., White E., Lin R.Z., Su X., Tuveson D.A, & Zong W.X. (2019). Glutamine Anabolism Plays a Critical Role in Pancreatic Cancer by Coupling Carbon and Nitrogen Metabolism. Cell reports, 29(5), 1287-1298.e6.
+ Open protocol
+ Expand
2

Modulating GLUL, IDH2, and DLST expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Expression: mouse GLUL expression cDNA was cloned into pLPC retroviral vector. Short-hairpin RNA (shRNA): pLKO-based shRNA plasmids were purchased from Sigma-Aldrich
Mouse GLUL shRNA (NM_008131, #1: TRCN0000309816; #2: TRCN0000309745). Human IDH2 shRNA (SHCLNG-NM_002168, #1: TRCN0000229434; #2: TRCN0000229778). The following sequencesagainst DLST werecloned into pLKO.1 plasmid: shDLST#1: TGTCTCATAGCCTCGAATATC; shDLST#2: CGAAAGAATGAACTTGCCATT. CRISPR/Cas9 short guide RNA (sgRNA): for the organoid study, sgRNAs were cloned into the LRNG vector (pLenti-sgRNA-EFS-Neo-IRES-GFP) (Roe et al., 2017 (link)). Control sgRNA: sgRosa26 GAAGATGGGCGGGAGTCTTC; for mouse GLUL silencing, sgGLUL#1: TGGGATCGTAGGCGCGAATG; sgGLUL#2 CATTCGCGCCTACGATCCCA. pLenti-Cas9-Puro (Addgene #108100) was used for the expression of spCas9. For human cell culture, sgRNA of human GLUL was cloned into pLentiCRISPRv2 (Addgene #52961). sgGLUL: GCGCTGCAAGACCCGGACCC. For mouse cell culture and orthotopic studies, a pool of three plasmids each containing a 20 nt guide RNA sequence specific to mouse GLUL was purchased from Santa Cruz Biotechnologies (sc-420579).
Bott A.J., Shen J., Tonelli C., Zhan L., Sivaram N., Jiang Y.P., Yu X., Bhatt V., Chiles E., Zhong H., Maimouni S., Dai W., Velasquez S., Pan J.A., Muthalagu N., Morton J., Anthony T.G., Feng H., Lamers W.H., Murphy D.J., Guo J.Y., Jin J., Crawford H.C., Zhang L., White E., Lin R.Z., Su X., Tuveson D.A, & Zong W.X. (2019). Glutamine Anabolism Plays a Critical Role in Pancreatic Cancer by Coupling Carbon and Nitrogen Metabolism. Cell reports, 29(5), 1287-1298.e6.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!