Transit 293 reagent

Feline Pit1 and Pit2 plasmids were described in a previous report (17 (link)). PLAT-A (amphotropic MuLV)-packaging cells were transfected with expression vectors (pMSCVneo-fePit1, pMSCVneo-fePit2, or pMSCVneo empty vector) using the TransIT-293 reagent (Takara, Kusatsu, Japan). Two days later, the supernatants were collected, filtered through a 0.22 µm filter, and then used to infect MDTF cells in the presence of polybrene (10 µg/mL). PLAT-GP (an env-negative)-packaging cells were co-transfected with an MuLV 10A1 env gene-expression vector, along with the pMSCVneo-fePit1, pMSCVneo-fePit2, or pMSCVneo empty vector, using the TransIT-293 reagent (Takara). Two days later, the supernatants were collected, filtered through a 0.22 µm filter, and used to infect CHO cells in the presence of polybrene (10 µg/mL). The cells were cultured in a medium containing 600 µg/mL neomycin (G418) for 2 weeks. These cells were termed MDTF-fePit1, MDTF-fePit2, MDTF-empty, CHO-fePit1, CHO-fePit2, and CHO-empty for further analyses.

The TRC2-pLKO1-puro plasmid containing shRNA for mouse Rac1 (GGAGACGGAGCTGTTGGTAAA, TRCN0000310888) and the nonmammalian shRNA control plasmid (TRC2-pLKO.5-puro non-target shRNA #1) (SHC202) were purchased from Sigma-Aldrich. Either one of these shRNA expression lentiviral plasmids was introduced into HEK-293TN cells with lentiviral packaging plasmids (pMISSION GAG POL and pMISSION VSV-G) using the TransIT-293 Reagent (Takara Bio). Forty-eight hours later, the culture medium containing lentiviruses was collected and then filter-sterilized. 3T3-L1 cells were infected with the lentiviruses at a multiplicity of infection of 4000 in the culture medium supplemented with 7 μg/mL polybrene. Those 3T3-L1 cells that stably expressed shRNA were selected with 2 μg/mL puromycin for three days.

Pseudovirus infection (Fig. 2E and F; Fig. S2) was performed as previously described (3 (link), 14 (link), 24 (link), 37 (link), 48 (link), 53 (link)
– (link)
56 (link)). Briefly, lentivirus (HIV-1)-based, luciferase-expressing reporter viruses were pseudotyped with SARS-CoV-2 S proteins. Lenti-X 293T cells (500,000 cells) were cotransfected with 800 ng psPAX2-IN/HiBiT (36 (link)), 800 ng pWPI-Luc2 (36 (link)), and 400 ng plasmids expressing parental S or its derivatives using TransIT-293 Reagent (Takara, Cat# MIR2700) according to the manufacturer’s protocol. Two days posttransfection, the culture supernatants were harvested and filtrated. The pseudoviruses were stored at –80°C until use. The amount of pseudoviruses prepared was quantified by the HiBiT assay using a Nano Glo HiBiT lytic detection system (Promega, Cat# N3040) as previously described (36 (link), 57 (link)). For the measurement of pseudovirus infectivity, the same amount of pseudoviruses (normalized to the HiBiT value, which indicates the amount of HIV-1 p24 antigen) was inoculated into HOS-ACE2/TMPRSS2 cells, and viral infectivity was measured as described above (see the “Neutralization assay” section).