To analyze transgene expression, RNA was extracted using an RNeasy Plant Mini Kit (QIAGEN) and converted to cDNA with Superscript III Reverse Transcriptase (Invitrogen). PCRs were performed with transgene-specific primers (Table S2 ), and ACTIN-2 was amplified for use as a loading control. For transcriptomic analysis of NO-deficient mutants, mutant and Col-0 seedlings were grown under long days (16 hr light/8 hr darkness) and harvested 5 hr after dawn on day 15. Total RNA was isolated and purified using the Micro-to-Midi Total RNA Purification System (Invitrogen). Labeling, hybridization protocols, and statistical analyses are described in Table S1 .
Micro to midi total rna purification system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The Micro-to-Midi total RNA purification system is a lab equipment product designed for the extraction and purification of total RNA from a wide range of sample types. The system utilizes a silica-based membrane technology to efficiently capture and purify RNA, enabling researchers to obtain high-quality RNA suitable for various downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Rneasy plant mini kit, by Qiagen (1 mentions)
Mas 5, by Thermo Fisher Scientific (1 mentions)
Mouse 430 2.0 genechip, by Thermo Fisher Scientific (1 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Iq sybr green supermix, by Bio-Rad (1 mentions)
5 aza 2 deoxycytidine, by Merck Group (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Ovation pico wta system v2, by Tecan (1 mentions)
Sybr premix ex taq 2 reagent, by Takara Bio (1 mentions)
Nucleospin rna 2 kit, by Macherey-Nagel (1 mentions)
Rotor gene sybr green pcr master mix, by Qiagen (1 mentions)
Quantitect primer assay, by Qiagen (1 mentions)
Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (1 mentions)
Rotor gene q, by Qiagen (1 mentions)
7 protocols using micro to midi total rna purification system
1
Gene Expression Analysis in Plants
2
Embryonic Stem Cell Transcriptome Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Independent biological replicates of WT (n = 2), calr−/− (n = 5), and calr truncation mutants NP (n = 3) and PC (n = 3) were cultured on 0.1 % gelatin-coated 10 cm dishes in 7.5 % FBS in DMEM supplemented with L-glutamine, NEAA, penicillin/streptomycin, LIF, and BME. Media was changed regularly every 24 or 48 h. Cells reaching ~80 % confluency were passaged 1:10 to maintain proliferative undifferentiated state of all cell lines, as previously performed [18 (link)]. Total RNA isolation from embryonic stem cells was performed using the Micro-to-Midi Total RNA Purification System (Invitrogen, Carlsbad, CA) for analysis of transcriptome dynamics. Double stranded complementary cDNA and labeled complementary cRNA were obtained from isolated total RNA, with the latter hybridized against the Mouse 430 2.0 GeneChip (Affymetrix). Arrays were scanned using an argon-ion laser, and visualized using MAS 5.0 Affymetrix software to assess quality of hybridization. Data were deposited to the Gene Expression Omnibus (GEO) repository under accession number GSE13805, with relevant updates.
3
Opn1mw C198R Mutation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from WT, Opn1mwC198R, and Opn1mwC198ROpn1sw–/– mouse retinas using a Micro-to-Midi total RNA purification system (Invitrogen). DNase treatment before the reverse transcription was performed to prevent amplification from genomic DNA contamination. First-strand cDNA was generated with SuperScript II reverse transcriptase (Invitrogen). Real-time PCR was performed with iQ SYBR green supermix (Bio-Rad) according to manufacturer’s instructions. The sequences of the primers were TGTGTCATTGAAGGCTACAT (forward) and TGACCATGAGGACCATCATA (reverse), derived from different exons of Opn1mw surrounding the C198R mutation. The PCR products were analyzed by agarose gel electrophoresis, followed by Sanger sequencing to confirm the presence of a C198R mutation.
4
Epigenetic Modulation in DU145 Cells
5
CTAB-Based DNA and RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from young leaves with a CTAB method as described in our previous study [22 ]. Total RNA was extracted using Micro-to-Midi Total RNA Purification System (Invitrogen) and following the manufacturer's protocols. The quality of DNA and RNA was checked by electrophoresis in 1.0% TAE agarose gel.
6
Quantification of Gene Expression in Schistosoma Developmental Stages
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was purified from parasite egg, sporocyst, cercaria and schistosomula using Micro-to-Midi total RNA purification system (Invitrogen, USA), and from adult worms using NucleoSpin RNA II kit (Macherey-Nagel, Germany). Reverse transcription and amplification of the double stranded cDNAs were performed using Ovation Pico WTA System v2 (NuGEN, USA). For each candidate gene and the reference gene (S. japonicum β-Actin), PCR fragment was first cloned into pCR2.1 cloning vector and the resulting constructs used as templates for qPCR standards and for estimation of copy numbers. Relative expression of candidate genes in different developmental stages of the parasite was quantified using SYBR Premix Ex Taq II Reagents (Takara, Japan). Real-time PCR and data analysis were performed on AB 7500 Real-Time PCR Systems v2.0.5.
7
Analyzing TGF-β1 Induced Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from WM35, A375 and A2058 cell lines stimulate or not with TGF-β1 using the Micro-to-Midi total RNA purification system (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's instructions. RNA was reverse transcribed into cDNA using the SuperScript III First-Strand Synthesis system (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions.
mRNA expression was measured using SYBR-Green RT-qPCR using the Rotor-Gene Q thermal cycler (Qiagen, Inc., Valencia, CA, USA).
Amplification reactions were performed using primers specific for FOXP3 (forward, 5′-CACAACATGCGACCCC CTTTCACC-3′ and reverse, 5′-AGGTTGTGGCGGAT GGCGTTCTTC-3′), NOTCH1 and HES1 (QuantiTect® Primer Assay; Qiagen, Inc.). The PCR reaction was carried out in 25 μl buffer, containing 50 ng cDNA, 1 μM of each primer and 12.5 μl 2X RotorGene SYBR-Green PCR Master Mix (Qiagen, Inc.). The thermal cycling conditions were as follows: denaturation at 95°C for 5 min, followed by 40 cycles of denaturation for 10 sec at 95°C and annealing and extension for 15 sec at 60°C. As housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH; QuantiTect Primer assay; Qiagen, Inc.) was used. Transcripts quantification was carried out utilizing the software supplied with Rotor-Gene Q. The experiments were repeated three times.
mRNA expression was measured using SYBR-Green RT-qPCR using the Rotor-Gene Q thermal cycler (Qiagen, Inc., Valencia, CA, USA).
Amplification reactions were performed using primers specific for FOXP3 (forward, 5′-CACAACATGCGACCCC CTTTCACC-3′ and reverse, 5′-AGGTTGTGGCGGAT GGCGTTCTTC-3′), NOTCH1 and HES1 (QuantiTect® Primer Assay; Qiagen, Inc.). The PCR reaction was carried out in 25 μl buffer, containing 50 ng cDNA, 1 μM of each primer and 12.5 μl 2X RotorGene SYBR-Green PCR Master Mix (Qiagen, Inc.). The thermal cycling conditions were as follows: denaturation at 95°C for 5 min, followed by 40 cycles of denaturation for 10 sec at 95°C and annealing and extension for 15 sec at 60°C. As housekeeping gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH; QuantiTect Primer assay; Qiagen, Inc.) was used. Transcripts quantification was carried out utilizing the software supplied with Rotor-Gene Q. The experiments were repeated three times.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!