Megaclear spin columns
The MEGAclear spin columns are a laboratory equipment designed for efficient nucleic acid purification. They utilize a silica-based membrane to selectively bind and retain nucleic acids while allowing contaminants to pass through. The columns are suitable for purifying a variety of nucleic acid types, including DNA, RNA, and oligonucleotides, from various sample types.
Lab products found in correlation
5 protocols using megaclear spin columns
In Vitro Synthesis of Modified mRNA
Generation and Purification of Modified mRNA
In vitro mRNA Production and Purification
ATGAACGCCAAGGTCGTGGTCGTGCTGGTCCTCGTG; CTGACCGCGCTCTGCCTCAGCGACGGGAAGCCCGTC; AGCCTGAGCTACAGATGCCCATGCCGATTCTTCGAA; AGCCATGTTGCCAGAGCCAACGTCAAGCATCTCAAA; ATTCTCAACACTCCAAACTGTGCCCTTCAGATTGTAG; CCCGGCTGAAGAACAACAACAGACAAGTGTGCATTG; ACCCGAAGCTAAAGTGGATTCAGGAGTACCTGGAGA; AAGCTTTAAACAAGTAA
Synthesis and Purification of modRNA
Synthesis of Modified mRNA for FUT6
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!