The largest database of trusted experimental protocols

Megaclear spin columns

Manufactured by Thermo Fisher Scientific

The MEGAclear spin columns are a laboratory equipment designed for efficient nucleic acid purification. They utilize a silica-based membrane to selectively bind and retain nucleic acids while allowing contaminants to pass through. The columns are suitable for purifying a variety of nucleic acid types, including DNA, RNA, and oligonucleotides, from various sample types.

Automatically generated - may contain errors

5 protocols using megaclear spin columns

1

In Vitro Synthesis of Modified mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
PTEN-mRNA and TRAIL-mRNA were synthesized in vitro, as previously described.40 (link) Briefly, the human 5′UTR with Kozak sequence and 3′UTR sequence were commercially synthesized by Integrated DNA Technologies (Coralville, Iowa,USA) and sub-cloned into pcDNA3.3. The MEGAscript T7 Kit (Thermo FisherWaltham) was used to synthesize mRNAs, whereas m7GpppG was replaced with Anti-Reverse Cap Analog (ARCA) cap analog (New England Biolabs) and cytidine and uridine were replaced with 5-methylcytidine triphosphate and pseudouridine triphosphate (TriLink BioTechnologies), respectively. Reactions were sustained for 5 h at 37°C followed by DNase treatment. Then, the reactions were treated with Antarctic Phosphatase (New England Biolabs) for 2 h at 37°C to remove residual 5′-triphosphates. The synthesized mRNAs were purified with MEGAclear spin columns (Ambion) and quantitated with NanoDrop (Thermo Scientific).
+ Open protocol
+ Expand
2

Generation and Purification of Modified mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
We purchased pcDNA3.3-SOX2 and pcDNA3.3 enhanced green fluorescent protein (EGFP) from ADDGENE (Cambridge, MA, USA), and mRNA-SOX2 was synthesized as previously described34 (link). In brief, plasmid DNAs were used as the template for poly-(A) tail polymerase chain reaction (PCR). The forward and reverse primers 5′-TTG GAC CCT CGT ACA GAA GCT AAT ACG-3′ and 5′-T (120)-CTT CCT ACT CAG GCT TTA TTC AAA GAC CA-3′ were used. After generation of poly-(A) tailed DNA fragments, tail PCR products were purified using a PureLink PCR purification kit (Invitrogen, Carlsbad, CA, USA). RNA was synthesized using a MEGAscript T7 kit (Ambion, Carlsbad, CA, USA) with purified tail PCR product. We also used a Cap/NTP mixture with an m7G(5′)ppp(5′)G ARCA cap analog (New England Biolabs, Manchester, CT, USA), 3′-methylcytidine triphosphate and pseudo-uridine triphosphate (TriLink Biotechnologies, San Diego, CA, USA) following the protocol for generation of modified mRNA. To generate unmodified mRNA, we made a Cap/NTP mixture using ATP, CTP, UTP, and GTP components. Reactions were incubated for 3–6 h at 37°C, and DNase and Antarctic phosphatase (New England Biolabs) were also added. Synthesized mRNAs were purified using MEGAclear spin columns (Ambion) according to the manufacturer’s protocol and quantitated with a NanoDrop spectrophotometer.
+ Open protocol
+ Expand
3

In vitro mRNA Production and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols
The mRNA was produced in vitro according to the previously described,15 transcribed using the RNA polymerase T7 on a DNA linearization template with generic 5′‐and 3′‐UTRs and poly‐A tails. The RNA was purified using the Ambion MEGA clear spin columns. Then, Antarctic Phosphatase (New England Biolabs) was introduced for 30 min at 37°C to remove the residual 5′‐phosphates upon initiation of treatment. Spectrophotometers from Thermo Scientific were used to quantify the purity of RNA as well as its concentration. The RNA was purified and resuspended at 1 μg/μl in 10 mM Tris HCl, 1 mM EDTA before use. The N1‐methylpseudouridine replaced uridine in mRNA. GFP and luciferase sequences were used as previously described.16 The sequence of SDF‐1α modRNA open reading frames is as follows:
ATGAACGCCAAGGTCGTGGTCGTGCTGGTCCTCGTG; CTGACCGCGCTCTGCCTCAGCGACGGGAAGCCCGTC; AGCCTGAGCTACAGATGCCCATGCCGATTCTTCGAA; AGCCATGTTGCCAGAGCCAACGTCAAGCATCTCAAA; ATTCTCAACACTCCAAACTGTGCCCTTCAGATTGTAG; CCCGGCTGAAGAACAACAACAGACAAGTGTGCATTG; ACCCGAAGCTAAAGTGGATTCAGGAGTACCTGGAGA; AAGCTTTAAACAAGTAA
+ Open protocol
+ Expand
4

Synthesis and Purification of modRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
modRNA was synthesized and formulated as previously described [19 (link)]. T7 RNA polymerase-mediated transcription from a linearized DNA template, which incorporates generic 5′and 3′UTRs and a poly-A tail, was used for mRNA synthesis. The purification of RNA was performed using Ambion MEGA clear spin columns. RNA was then treated with Antarctic Phosphatase (New England Biolabs) at 37 °C for 30 min to remove residual 5′-phosphates. After re-purification and quantification by Nanodrop (Thermo Scientific), RNA was resuspended in 10 mM Tris HCl, 1 mM EDTA at 1 μg/μl for use. In mRNA, uridine was fully replaced by N1-methylpseudouridine. GFP and firefly luciferase ORF sequences were the same as previously described [14 (link)]. Open reading frame sequence for mouse IGF-1 modRNA was provided in the supplementary data (Additional file 1: Table S1).
+ Open protocol
+ Expand
5

Synthesis of Modified mRNA for FUT6

Check if the same lab product or an alternative is used in the 5 most similar protocols
Modified mRNA (modRNA) was synthesized as described previously [14 (link)]. Briefly, cDNA encoding human Fucosyltransferase 6 (FUT6) was sub-cloned into a vector containing T7 promoter, 5′ UTR and 3′ UTR. PCR reactions were performed to generate template for in vitro transcription with HiFi Hotstart (KAPA Biosystems). 1.6 μg of purified PCR product including FUT6 ORF and 5′ and 3′ UTR was used as template for RNA synthesis with MEGAscript T7 kit (Ambion). 3′-0-Me-m7G(5′)ppp(5′)G ARCA cap analog (New England Biolabs), adenosine triphosphate and guanosine triphosphate (USB), 5-methylcytidine triphosphate and pseudouridine triphosphate (TriLink Biotechnologies) were used for in vitro transcription reaction. modRNA product was purified using MEGAclear spin columns (Ambion), and aliquots were stored frozen for future use. Nuclear destabilized EGFP (ndGFP) modRNA was similarly prepared as a negative control.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!