Log In Sign up
The largest database of trusted experimental protocols

Z vad fmk

Manufactured by Enzo Life Sciences
Visit Supplier
Sourced in United States, Germany, France, Switzerland, United Kingdom

Z-VAD-FMK is a broad-spectrum caspase inhibitor. It binds irreversibly to the catalytic site of caspase enzymes, thereby blocking their activity.

Automatically generated - may contain errors

Lab products found in correlation

Z ietd fmk, by R&D Systems (7 mentions) Z lehd fmk, by R&D Systems (7 mentions) Dimethyl sulfoxide (dmso), by Merck Group (7 mentions) Cycloheximide (chx), by Merck Group (6 mentions) Propidium iodide, by Merck Group (5 mentions) Tnf α, by Thermo Fisher Scientific (5 mentions) Abt 199, by Chemietek (4 mentions) Gentamicin, by Merck Group (4 mentions) Necrostatin 1, by Enzo Life Sciences (4 mentions) N acetyl cysteine (nac), by Merck Group (4 mentions) Dexamethasone (dex), by Merck Group (4 mentions) Mg132, by Merck Group (4 mentions) Necrostatin 1, by Merck Group (4 mentions) Lipopolysaccharides (lps), by InvivoGen (3 mentions) Mg132, by Enzo Life Sciences (3 mentions) Z vdvad fmk, by R&D Systems (3 mentions) N acetylcysteine, by Merck Group (3 mentions) N acetyl l cysteine nac, by Merck Group (3 mentions) Cytochalasin d, by Merck Group (3 mentions) Suramin, by Merck Group (3 mentions)

Spelling variants of this product

Z-VAD-FMK (Z-VAD) (5 citations) Pan-caspase inhibitor Z-VAD-FMK (4 citations) Z-VAD(OMe)-fmk (3 citations)

122 protocols using z vad fmk

1

Chemotherapeutic Resistance Mechanisms in Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Prostate cancer PC3 cells obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China) and docetaxel‐resistant PC3/Doc cells, as previously described 11, lung adenocarcinoma H460 and paclitaxel‐resistant H460/RT cells, oral epithelium carcinoma KB cells and the vincristine‐resistant KB/VCR cells, murine PCa RM‐1 cells (The Cell Bank of Chinese Academy of Sciences) and RM‐1/Doc cells (docetaxel‐resistant cell line derived from RM‐1) were cultured in RPMI 1640 medium (HyClone, Logan, UT, USA) supplemented with 10% foetal bovine serum (GIBCO, Grand Island, NY, USA), 100 U/ml penicillin and 100 g/ml streptomycin.
Trichostatin A (TSA), suberoylanilide hydroxamic acid (SAHA), the PI3K inhibitor LY294002, cycloheximide (CHX), actinomycin (Act D) and sodium tauroursodeoxycholate (TUDCA) were purchased from Sigma‐Aldrich (St‐Louis, MO, USA). The pan‐caspase inhibitor Z‐VAD‐fmk was obtained from Enzo Life Sciences (Plymouth Meeting, PA, USA).
In some experiments, the cells were exposed to Z‐VAD‐fmk, CHX, LY294002 or Act D for 2 hrs before TSA treatment. DMSO was used as the control vehicle.
Xu Q., Liu X., Zhu S., Hu X., Niu H., Zhang X., Zhu D., Nesa E.U., Tian K, & Yuan H. (2018). Hyper‐acetylation contributes to the sensitivity of chemo‐resistant prostate cancer cells to histone deacetylase inhibitor Trichostatin A. Journal of Cellular and Molecular Medicine, 22(3), 1909-1922.
+ Open protocol
+ Expand
2

Apoptosis and Necroptosis Induction in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
L929 cells were treated with 1 μM staurosporine (STA; Abcam, Cambridge, MA) to induce apoptosis or with TZS, consisting of 12.5 ng/ml TNF-α (Enzo Life Sciences, Farmingdale, NY), 20 μM Z-VAD–fmk (Enzo Life Sciences), and 100 nM SMAC mimetic (Birinapant; Chemietek, Indianapolis, IN) to induce necroptosis. RIP1−/− or FADD−/− Jurkat cells were treated with human TNF-α (50 ng/ml; Enzo Life Sciences), for 6–20 h and then stained with annexin V and 7-aminoactinomycin D (7-AAD) using annexin V binding buffer (BD Biosciences, San Jose, CA), at 4°C for 30 min. To confirm the specificity of cell death for RIP1−/− or FADD−/− Jurkat cells, cells were treated with 20 μM Z-VAD–fmk (Enzo Life Sciences) or 50 μM necrostatic-1 (Nec-1; Cayman Chemical, Ann Arbor, MI), inhibitors of apoptosis and necroptosis, respectively.
Zhu M., Barbas A.S., Lin L., Scheuermann U., Bishawi M, & Brennan T.V. (2018). Mitochondria Released by Apoptotic Cell Death Initiate Innate Immune Responses. ImmunoHorizons, 2(11), 384-397.
+ Open protocol
+ Expand
3

Apoptosis and Necroptosis Induction in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
L929 cells were treated with 1 μM staurosporine (STA; Abcam, Cambridge, MA) to induce apoptosis or with TZS, consisting of 12.5 ng/ml TNF-α (Enzo Life Sciences, Farmingdale, NY), 20 μM Z-VAD–fmk (Enzo Life Sciences), and 100 nM SMAC mimetic (Birinapant; Chemietek, Indianapolis, IN) to induce necroptosis. RIP1−/− or FADD−/− Jurkat cells were treated with human TNF-α (50 ng/ml; Enzo Life Sciences), for 6–20 h and then stained with annexin V and 7-aminoactinomycin D (7-AAD) using annexin V binding buffer (BD Biosciences, San Jose, CA), at 4°C for 30 min. To confirm the specificity of cell death for RIP1−/− or FADD−/− Jurkat cells, cells were treated with 20 μM Z-VAD–fmk (Enzo Life Sciences) or 50 μM necrostatic-1 (Nec-1; Cayman Chemical, Ann Arbor, MI), inhibitors of apoptosis and necroptosis, respectively.
Zhu M., Barbas A.S., Lin L., Scheuermann U., Bishawi M, & Brennan T.V. (2018). Mitochondria Released by Apoptotic Cell Death Initiate Innate Immune Responses. ImmunoHorizons, 2(11), 384-397.
+ Open protocol
+ Expand
4

Preparing Potent Compounds for Research

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bleomycin (Sigma-Aldrich, St. Louis. MO, USA) was dissolved in sterilized water to generate 3 U/mL stock for further dilution. Sodium selenite (Sigma-Aldrich) was dissolved in sterilized phosphate-buffered saline (PBS) to generate 20 mM stock for further dilution. 1,3-Bis(2-chloroethyl)-1-nitrosourea (BCNU) (Sigma-Aldrich) was dissolved in dimethyl sulfoxide (DMSO) to generate 95.3 mM stock for further dilution. Avertin, Pancuronium, Chloroquine (CQ), Necrostatin-1(Nec-1), and Ferrostatin-1(Fer-1) were purchased from Sigma-Aldrich, and Z-VAD-FMK was purchased from Enzo (Taipei, Taiwan).
Lin J.H., Liu C.C., Liu C.Y., Hsu T.W., Yeh Y.C., How C.K., Hsu H.S, & Hung S.C. (2024). Selenite selectively kills lung fibroblasts to treat bleomycin-induced pulmonary fibrosis. Redox Biology, 72, 103148.
+ Open protocol
+ Expand
5

Inflammasome Activation and Pyroptosis Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies used include: GSDMD Rabbit polyclonal Ab (Novus Biologicals, NBP2–33422), FLAG® M2 monoclonal Ab (Sigma, F3165), GAPDH Rabbit monoclonal Ab (Cell Signaling Tech, 14C10), CASP1 p20 Rabbit polyclonal Ab (Cell Signaling Tech, 2225s), CASP1 p12/10 Rabbit monoclonal Ab (Abcam, ab179515), CASP4 Rabbit polyclonal Ab (Cell Signaling Tech, 4450S), CASP5 Rabbit monoclonal Ab (Cell Signaling Tech, 46680S), Myc Mouse monoclonal Ab (Cell Signaling Tech, 2276S), V5 Rabbit monoclonal Ab (Cell Signaling Tech, 13202S), hIL-1β Goat Polyclonal Ab (R&D systems, AF-201-NA), hIL-18 Goat Ab (R&D systems, af2548), hIL-1α Recombinant Ab (PeproTech, 200–01A), PARP Rabbit polyclonal Ab (Cell Signaling Tech, 9542S), HA Rabbit monoclonal Ab (Cell Signaling Tech, 3724S), mIL-1β Goat polyclonal Ab (R&D systems, AF-401-NA), CASP11 Rat monoclonal Ab (Novus Biologicals, NB120–10454), FKBP12 Rabbit polyclonal Ab (Abcam, ab24373). IRDye 800CW anti-rabbit (LICOR, 925–32211), IRDye 800CW anti-mouse (LI-COR, 925–32210), IRDye 680CW anti-rabbit (LI COR, 925–68073), IRDye 680CW anti-mouse (LI-COR, 925–68072). Other reagents used include: LPS-EB Ultrapure (Invivogen, tlrl-3pelps), VX-765 (Apexbio Technology LLC, 50–101-3604), Z-VAD-FMK (Enzo Life Sciences, NC9471015), FuGENE HD (Promega, E2311), AP20187 (Tocris™ 6297/5), NP-40 Lysis Buffer Low Salt (Thomas Scientific, C994H79).
Exconde P.M., Hernandez-Chavez C., Bray M.B., Lopez J.L., Srivastava T., Egan M.S., Zhang J., Shin S., Discher B.M, & Taabazuing C.Y. (2023). The tetrapeptide sequence of IL-1β regulates its recruitment and activation by inflammatory caspases. bioRxiv.
+ Open protocol
+ Expand
6

Molecular Signaling Pathway Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Specific antibodies to GAPDH, SOD, catalase, p53, Nrf2, and HO-1 were purchased from Santa Cruz (Santa Cruz, CA, USA). Monoclonal antibodies to β-actin were obtained from Millipore (Burlingame, CA, USA). Polyclonal antibodies to caspase-3, -9, PARP, Bax, Bcl-xL, phosphor-p53, ERK, and phospho-ERK were purchased from Cell Signaling (Beverly, MA, USA). U0126 and Z-VAD-FMK were obtained from Enzo Life Science (New York, NY, USA).
Hung Y.C., Wang P.W., Lin T.Y., Yang P.M., You J.S, & Pan T.L. (2020). Functional Redox Proteomics Reveal That Salvia miltiorrhiza Aqueous Extract Alleviates Adriamycin-Induced Cardiomyopathy via Inhibiting ROS-Dependent Apoptosis. Oxidative Medicine and Cellular Longevity, 2020, 5136934.
+ Open protocol
+ Expand
7

Caspase Activation and Pyroptosis Assays

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
LPS was purchased from Santa Cruz Biotechnology, nigericin, and vildagliptin and Ac-YVAD-CMK from the Cayman Chemical Company, PMA and sitagliptin from Sigma, Ala-Pro-AFC from Bachem, saxagliptin from Toronto Research Chemicals, and Z-VAD-FMK and etoposide from Enzo Life Sciences. Val-boroPro45 (link), 1G24424 (link), FP-biotin15 (link), L-allo-Ile-isoindoline14 (link), and L-allo-Ile-thiazolidine14 (link) were synthesized according to previously published protocols. For cell culture experiments, Val-boroPro was resuspended in DMSO containing 0.1% TFA to prevent compound cyclization. Antibodies used include: human caspase-1 (#2225, Cell Signaling Technology), mouse caspase-1 (clone Casper-1, Adipogen), caspase-3 (clone 8G10, Cell Signaling Technology), human caspase-4 (clone 4B9, Santa Cruz), human caspase-5 (clone D3G4W, Cell Signaling Technology), caspase-7 (clone D2Q3L, Cell Signaling Technology), human IL-1β (Clone 2805, R&D Systems), mouse IL-1β (clone D4T2D, Cell Signaling Technology), IL-1α (#AF-200, R&D Systems), IL-18 (#AF2548, R&D Systems), GAPDH (clone 14C10, Cell Signaling Technology), DPP7 (Clone 398024, R&D Systems), DPP8 (ab42076, Abcam), DPP9 (ab42080, Abcam), PARP (#9542, Cell Signaling Technology), GSDMD (NBP2-33422, Novus Biologicals), DPP4 (#11D7, GeneTex), FAP (ABT11, Millipore), and SCPEP1 (SAB2700267, Sigma).
Okondo M.C., Johnson D.C., Sridharan R., Go E.B., Chui A.J., Wang M.S., Poplawski S.E., Wu W., Liu Y., Lai J.H., Sanford D.G., Arciprete M.O., Golub T.R., Bachovchin W.W, & Bachovchin D.A. (2016). DPP8/9 inhibition induces pro-caspase-1-dependent monocyte and macrophage pyroptosis. Nature chemical biology, 13(1), 46-53.
+ Open protocol
+ Expand
8

Riccardin D Derivative and Cell Death Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols
RD‐N was the aminomethylated derivative of riccardin D and its structure was identified as reported previously.1 The compound was dissolved in dimethyl sulfoxide (DMSO, Sigma‐Aldrich, St. Louis, MO) at 10 mmol/L as stock solution. E64d and z‐VAD‐fmk were obtained from Enzo Life Sciences. CA074Me was acquired from Calbiochem. Z‐RR‐AMC was purchased from the EMD Chemicals. Propidium iodide (PI) was purchased from Sigma‐Aldrich.
Wang Y., Niu H., Hu Z., Zhu M., Wang L., Han L., Qian L., Tian K., Yuan H, & Lou H. (2018). Targeting the lysosome by an aminomethylated Riccardin D triggers DNA damage through cathepsin B‐mediated degradation of BRCA1. Journal of Cellular and Molecular Medicine, 23(3), 1798-1812.
+ Open protocol
+ Expand
9

Investigating Rab32 in Neuronal Apoptosis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
mCherry-labeled Rab32 shRNA psi-mH1 plasmids (HSH001118) as well as scrambled control (CSHCTR001) were purchased from Genecopoeia (Rockland MD). FLAG-tagged Rab32 constructs were expressed from pcDNA3 as published [22 (link)] (wt, wild type; Q85L, dominant-active; T39N, dominant-negative) or transferred into the bi-cistronic pIRES2-EGFP plasmid (Clontech-Takara, Mountain View, CA) that allows for the expression of any protein, in parallel with nuclear EGFP. To do so, the described constructs contained in pcDNA3 were PCR-amplified using the SP6 and TS484 (ATATGCTAGCACCATGGACTACAAGGACGACGATGACAAG) oligos following cuts with the 5’ Nhe1 and 3’ Xho1 sites. Primary neurons or SH-SY5Y neuronal cell lines were transfected by nucleofection (Lonza, Mississauga, ON). Immunofluorescence was performed as described [25 (link)]. To assay neurotoxicity, nuclear EGFP was used to identify transfected HFNs and SH-SY5Y. Apoptosis was then detected by Cy5-annexin V binding (BD Biosciences). Assays were repeated in the presence of bafilomycin (100 nM, Sigma-Aldrich), necrostatin-1 (nec-1, 50 μM, Cayman Chemical), carbobenzoxy-valyl-alanyl-aspartyl-[O-methyl]- fluoromethylketone (zVAD-fmk) (10 μM, Enzo Life Sciences, Farmingdale, NY), or with a combination of nec-1 and zVAD-fmk.
Haile Y., Deng X., Ortiz-Sandoval C., Tahbaz N., Janowicz A., Lu J.Q., Kerr B.J., Gutowski N.J., Holley J.E., Eggleton P., Giuliani F, & Simmen T. (2017). Rab32 connects ER stress to mitochondrial defects in multiple sclerosis. Journal of Neuroinflammation, 14, 19.
+ Open protocol
+ Expand
10

Combination Treatment Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Docetaxel (Tocris), recombinant TRAIL (PeproTech), z-VAD-fmk (Enzo Life Sciences), TRAIL-R2 (DR5) neutralizing antibody (R&D system), and human control IgG (Jackson Immuno Research) were used to treat the cell lines.
Chung A.H., Leisner T.M., Dardis G.J., Bivins M.M., Keller A.L, & Parise L.V. (2019). CIB1 depletion with docetaxel or TRAIL enhances triple-negative breast cancer cell death. Cancer Cell International, 19, 26.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!