Dual glo luciferase reporter assay kit

We applied a luciferase reporter gene assay to confirm a direct link between Nrf2 and HO-1 in primary astrocytes. A fragment of HO-1, containing the promotor binding sequence (from -500 bp upstream to 100 bp downstream), was cloned to a luciferase reporter construct (GenePharma). Overexpressed Nrf2 plasmid (Nrf2) (GenePharma) was constructed by empty vector PCDNA 3.1 and transfected into astrocytes on 12-well plates, while PCDNA 3.1 was used as a negative control (NC). Furthermore, we constructed a mutation promotor of HO-1 at the same location with luciferase reporter, the mutation sites shown in Supplementary Figure S1a, and then Nrf2 plasmid and NC plasmid were transfected. 24 h later, the Dual-Glo Luciferase Reporter Assay kit (Promega) was applied to measure luciferase activity.

The 908-bp human PCSK9 3′-UTR containing the miR-483 putative binding site was subcloned (forward primer, CGGACTAGTACTGTGGGGCATTTCACCAT, reverse primer, CGACGCGTGCAACAGAGAGGACAGACCC; restriction enzyme cutting on both ends with SpeI and MluI, respectively) into the pMIR-REPORT vector (Ambion) to generate the pMIR-Luc-PCSK9-3′-UTR WT reporter [Luc-PCSK9 (WT)]. Then the CGG to GCC mutations in the miR-483 binding seed sequence of the PCSK9 3′-UTR were introduced into the Luc-PCSK9 (WT) plasmid by using the QuikChange Lightning Multi Site-Directed Mutagenesis Kit (Agilent Technologies). Renilla luciferase plasmid (pRL-TK) was used as the transfection control. Luc-PCSK9 (WT), Luc-PCSK9 (MT), and control pRL-TK plasmids were cotransfected into HepG2 cells by using Lipofectamine 2000 (Invitrogen). At 24 hours after transfection, cells were lysed for luciferase activity measurement with the Dual-Glo Luciferase Reporter Assay Kit (Promega).

Cells were transfected in a 12-well plate with same amount per plasmid (pcDNA3, pGL3 and pRL-CMV) using the Qiagen Effectene kit according to manufacturer’s manual and grown for 24 h. The transactivation assays were performed using the Promega Dual-Glo Luciferase reporter assay kit. Cells were washed with PBS (Gibco), harvested and assayed for firefly and renilla activity in a 96-well plate in quadruplicates. The ratio of the firefly to renilla signal was determined and normalized to empty vector. The remaining sample was used for determination of expression levels via western blot using the BioRad system. Three independent experiments have been performed for each transactivation assay. For statistical analysis, P-values were calculated in an unpaired t-test using the GraphPad t-test calculator (https://www.graphpad.com/quickcalcs/ttest1/?Format = SD).

Luciferase activities were measured by a Dual-Glo Luciferase Reporter Assay Kit (Promega). To elucidate whether Apaf1 was a target gene of miR-136, TargetScan (http://targetscan.org) and miRTarBase (http://miRTarBase.mbc.nctu.edu.tw) were used to predict the target genes that may be regulated by miRNA molecules. Apaf1was identified as a potential target which can be regulated by miR-136. Bioinformatic analysis identified two putative binding sites of miR-136 at positions 138–145 and 1091–1098 of Apaf1 3′UTR. Wild-type (WT) and mutant binding regions of miR-136 in the 3′UTR of Apaf1 gene were cloned into pMIR-REPORT luciferase reporter plasmids (Invitrogen, USA). Four plasmids were generated: (1) WT, (2) mutation 1 at positions 138–145, (3) mutation 2 at positions 1091–1098, and (4) dual mutations at both sites of 3′UTR of Apaf1 gene. These plasmids were individually cotransfected with miR-136 mimic (100 nM; Sangon Biotech Co. Ltd., Shanghai, China) or negative control mimics into HEK293T cells (ATCC, Manassas, VA, USA). Renilla luciferase reporter plasmids were transfected as an internal positive control. After cultivation at 37 °C for 24 h, cells were assayed using the dual-luciferase assay system (Promega, Madison, USA) according to the manufacturer’s instructions. All assays were repeated at least three times.

LNCaP, VCaP, and 22Rv1 cells were cultured in phenol red-free RPMI 1640 supplemented with 10% FBS in 96-well plates. After incubation for 24 h, transfection for dual luciferase assay was carried out as described previously [24 (link)]. 1 nM R1881 and DNT at each concentration were added to the cells and luciferase activity was measured after 24 h using the Dual-Glo luciferase reporter assay kit (Promega).

Hepatocellular carcinoma cells were transfected with reporter vector containing wild-type or mutated 3′-UTR of PYGB, together with miR-101-3p mimic or mimics negative control. The relative luciferase activity of HCC cells was normalized to Renilla luciferase activity 48 h after transfection using the Dual-Glo luciferase reporter assay kit (Promega, Madison, WI, United States).