Rt pcr system

After the cells were grouped and processed, total RNA was extracted using TRIzol reagent and then reverse transcribed into cDNA. Next, the samples were denatured at 94°C for 10 min and amplified at 94°C for 15 s, 60°C for 60 s, and 72°C for 60 s for 40 cycles. The primer sequences were as follows: ZO-1 sense: 5′-AGGTGAAACTCTGCTGAGCC-3′; ZO-1 antisense: 5′-TCCAGTGTGGCAAG CGTAG −3′; Claudin-5 sense: 5′-GAACTACGTCTAAGGGCGGG-3′; Claudin-5 antisense: 5′-AATTCAGCGGTG GTCGTCAT −3′; GRP78 sense: 5′-GTGCCCACCAAGAAGTCTCA −3′; and GRP78 antisense: 5′-TTTTGTCAGG GGTCGTTCACC −3′. An RT-PCR system (ABI) was used for quantification, and all the reactions were performed three times.

Total RNA was extracted with TRIzol (BRL Life and Technologies, MD). cDNAs were prepared and amplified from 2 μg of total RNA using the ThermoScript RT-PCR system with oligo (dT)_12-18 (Invitrogen, Carlsbad, CA), analyzed on 2% agarose gels, and confirmed by nucleotide sequencing. The following primer pairs were used for RT-PCR: HIF-1α (325 bp): 5′-ACTTCTGGATGCTGGTGATT-3′ (sense) and 5′-TCCTCGGCTAGTTAG GGTAC-3′ (antisense), HIF-1β (264 bp): 5′-ATGTCTAACGATAAGGAGCGGTTT-3′ (sense) and 5′-AAGTTTATCCACATCATCTGGGTG-3′ (antisense), cyclin A1 (415 bp): 5′-GCCTGGCAAACTATACTGTG-3′ (sense) and 5′-CTCCATGAGGGACACACACA-3′ (anti-sense), cyclin D1 (726 bp): 5′-CCCTCGGTGTCCTACTTCAAA-3′ (sense) and 5′-CACCTCCTCCTCCTCCTCTTC-3′ (antisense), and β-actin: 5′-GTTGCGTTACACCCTTTCTTG-3′ (sense) and 5′-TGCTGTCACCTTCACCGT TC-3′ (antisense, the amplimer was 133 bp). Amplification conditions were 95°C for 3 min, 35 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s. PCR products were detected using agarose gel electrophoresis. Densitometric analysisof PCR bandswas performed with a computerized image processing system (Quantity One; Bio-Rad, Hercules, CA).

Total RNA samples were extracted from the right hippocampus tissues using Trizol (Life Technologies,), and the concentration and purity of total RNA were determined by ultramicro spectrophotometry (Wuyi, Nanjing, China). The first strand cDNA is synthesized by the first strand cDNA synthesis kit according to the scheme of the manufacturer (TaKaRa). Real‐time polymerase chain reaction (RT‐PCR) system is used to detect quantitative RT‐PCR (Thermo Scientific). Based on the β‐reference expression of actin, the 2^−△△Ct method was used for the relative expression level of each gene. The primer sequences used for PCR were as follows: PI3K forward primer: 5′‐CGAAACAAAGCCGAGAACCT ‐3′; PI3K reverse primer: 5′‐GACGCAATGTTTGACTTCGC‐3′; AKT forward primer: 5′‐CAGGTTCACCCAGTGACAAC‐3′; AKT reverse primer: 5′‐CTCCTTCACCAGGATCACCT‐3′; Sirt1 forward primer: 5′‐TGACCTCCTCATTGTTATTGG‐3′; Sirt1 reverse primer: 5′‐ATTATGACATCGCAGTCTCCA‐3′; Gabarapl1 forward primer: 5′‐CAGCAACTCTCGTCACTTTG‐3′; Gabarapl1 reverse primer: 5′‐CAGCATTCTTTCCCCCTTTG‐3′; ATG12 forward primer: 5′‐CCCGTCTTCGGTTGCAGTTT‐3′; ATG12 reverse primer: 5′‐CGCTCCACAGCCCATTTCTT‐3′; beta‐actin forward primer: 5′‐CCCATCTATGAGGGTTACGC‐3′; beta‐actin reverse primer: 5′‐TTTAATGTCACGCACGATTTC‐3′.