Kicqstart primers

RNA was isolated using the RNeasy Plus Mini kits (Qiagen, 74134). cDNA was synthesized using Superscript IV, Oligo dT and dNTP (Invitrogen, 18090010). RT-qPCR was performed with the StepOne plus instrument (Applied Biosystems) using the SYBR Green master mix (Applied Biosystems, 4385617) and predesigned primers (KiCqStart Primers, Sigma, listed in Table 2). Relative gene expression levels were normalized to β-actin mRNA expression in each sample using the ΔΔCT method.Table 2

List of RT-qPCR primers

Genes	Forward primer	Reverse primer
RT-qPCR primers
Actb	GATGTATGAAGGCTTTGGTC	TGTGCACTTTTATTGGTCTC
Apoe	ACCTGATGGAGAAGATACAG	GATATGGATGTTGTTGCAGG
Arg1	GGAGACCACAGTCTGGCAGTTGGA	GGACACAGGTTGCCCATGC
Atg7	CTGTTCACCCAAAGTTCTTG	TCTAAGAAGGAATGTGAGGAG
Nfkb1	AGGACATGGGATTTCAGGA	GGAGGTGGATGATGGCTAA
Nfkb2	TCAAGATCTGTAACTATGAGGG	TTCTTCTTGGTTACATGCAG
Nos2	GCGGAGTGACGGCAAACAT	AGGTCGATGCACAACTGGG
Rel	ATACCTGCCAGATGAAAAAG	TCAGTAAAGTGACCACAATC
Rela	GCTCCTAAGGTGCTGACA	ACCTCCGAAAGCGAGATA
Relb	CGGATTTGCCGAATCAAC	CGGATATGTCCTCTTTTTGC

List of primer sequences used in this study. All the sequences are given 5ʹ to 3ʹ

Briefly, total RNA was extracted by resuspending cells in 500 μl TRI reagent (Invitrogen, Paisley, UK), according to the manufacturer's instructions. RNA was phase‐separated in chloroform and precipitated using isopropanol (both Sigma). Total RNA concentration was determined for each sample using a NanoDrop 2000 spectrophotometer (Thermo Scientific). All primers were predesigned and purchased from Sigma‐Aldrich (Table 1) (Kicqstart primers; Sigma, Irvine, UK). Quantitative real‐time RT‐PCR was performed using Quantifast™ SYBR® Green RT‐PCR one‐step kit on a ViiA™ 7 Real‐Time PCR system (Life Technologies). Parameters used were: hold 50°C for 10°min, 95°C for 5 min, 95°C for 10 s, 60°C for 30 s. Upon completion, dissociation/melting curve analyses were performed to exclude non‐specific amplifications and primer dimers. The PCR data were normalized to the reference gene ribosomal protein IIB (RPIIB). Relative gene expression levels were calculated from the cycle threshold (C_t) value using the comparative Ct equation (ΔΔC_t) or Livak method, where relative gene expression is calculated as 2^–ΔΔCt.

Each cultured construct was independently collected after 24 h of treatment. Total RNA extraction and cDNA synthesis were obtained using the FastLane Cell cDNA kit (Qiagen, Milano, Italy) with a TProfessional Basic Thermocycler (Biometra, Cinisello Balsamo-Milano, Italy), following manufacturer’s instruction. The RT-qPCR analyses were then performed with a RotorGene 6000 (Qiagen, Milano, Italy) using the SYBR® GreenERTM qPCR SuperMix Universal kit (Invitrogen Thermo Fisher, Monza, Italy). Target genes were amplified using specific primer pairs obtained from KiCqStart™ Primers (Sigma Aldrich, Milano, Italy). For each sample, the quality of the PCR product was tested by melting curve analysis. The results were expressed as fold change (increase or decrease) in expression of the treated sample in relation to the untreated sample. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as reference gene to control for experimental variability and the level of mRNA expression was normalized to GAPDH mRNA. RT-qPCR analysis was performed in duplicate on samples taken from three independent cultures (i.e., six measurements for each gene).

Total RNA was extracted using RNeasy Mini kits (Qiagen, Mississauga, ON, Canada). For mRNA analysis, cDNA was amplified by quantitative real-time PCR and normalized to 18S ribosomal RNA. Each reaction was performed in triplicate. Quantification was performed by the 2^-ΔΔCt method. Pre-optimized primers were obtained from Sigma (KiCqStart Primers).

Splenic NK cells were directly isolated by magnetic activated cell sorting (MACS) using an NK cell isolation kit (Miltenyi, Bergisch Gladbach, Germany). Thereafter, mRNA was isolated by using Dynabeads oligo (dT) (Invitrogen, Thermo Fisher Scientific Inc.) following manufacturer´s instructions. Synthesis of cDNA was performed by reverse transcriptase reaction according to the supplier's instruction as already described (Thermo Fisher Scientific Inc.) as already described^{72 (link)}. The mRNA concentrations of genes were measured by real-time polymerase chain reactions (qTower, Analytik Jena AG, Jena, Germany) using SYBR Green Fluorescein Mix (BioRad, München, Germany) and the specific primers (KiCq- Start Primers, Sigma Aldrich, Supplementary Table S3). For normalization of target gene values, the housekeeping gene peptidylprolyl isomerase A (Ppia) was used. The relative mRNA concentration was calculated using the ΔΔCt method and individual amplification efficiency for each primer, determined by a standard curve with different primer dilutions^{106 (link)}. The mRNA concentrations of genes were measured by realtime detection reverse transcriptase-PCR (iQ5, BioRad) using SYBR Green MIX (BioRad). For determination of mRNA concentration, a threshold cycle (Ct) was obtained from each amplification curve using the software qPCRsoft 3.4 (Analytik Jena AG).

Total RNA was extracted using miReasy kit (Qiagen). For mRNA analysis, cDNA was amplified by quantitative real‐time PCR (qPCR) and normalized to 18S ribosomal RNA. Each reaction was performed in triplicate. Quantification was performed by the 2^−ΔΔCt method 50. Primers are from Sigma (KiCqStart™ Primers).