7500 real time pcr cycler

Total RNA was isolated from MSCs after five days of culture before seeding them on POMA slides for ECM generation as well as from 24h stimulated MNCs using RNeasy Mini Kit (Qiagen, Germany) and reverse transcribed into cDNA using RevertAid cDNA synthesis kit (Thermo-Fisher, Germany) with oligo-dT primers. Relative target quantity was determined using the comparative CT(ΔΔCT) method. RT-PCR was performed using SYBR Green/ROX PCR master mix (Thermo-Fisher, Germany) and target specific primers (Supplementary Table S2) on a 7500 Real-time PCR cycler (Applied Biosystems, Germany). Amplicons were normalized to U6, respectively. All samples were run in duplicates.

Total RNA extraction was obtained using the TRIzol^® reagent (Life Technologies™ by Ambion, CA, USA), following the manufacturer’s instructions. Reverse transcription was performed using the reverse transcriptase enzyme ImPromII^® (Promega Co.^®, WI, USA) according to the manufacturer’s instructions to obtain complementary DNA (cDNA). The mRNA expression of heparanase isoforms (HPSE and HPSE2) and Syn-1 were analyzed using the following primers: HPSE forward, 5′TGGCAAGAAGGTCTGGTTAGGAGA3′ and reverse, 5′GCAAAGGTGTCGGATAGCAAGGG3′; HPSE2 forward, 5′AGACAGAG CTGCAGGTTTGAAGGA3′ and reverse, 5′AGCTTAGGAAATCGAGCCAGCCAT3′; Syn-1 forward, 5′AGGGCTCCTGCACTTACTTGCTTA3′ and reverse, 5′ATGTGCA GTCATACACTCCAGGCA3′. The expressions of the endogenous genes 60S ribosomal protein L13A (RPL13a) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were analyzed using the following primers: RPL13a forward, 5′TTGAGGACCTCTGTGTATTTGTCAA3′ and RPL13a reverse, 5′CCTGGAGGAGAAGAGGAAAGAGA3′; GAPDH forward, 5′TCGACAGTCAGCCGCATCTTCTTT3′ and GAPDH reverse, 5′GCCCAA TACGACCAAATCCGTTGA3′. The values are expressed as −ΔCt. Amplification was performed using Maxima^® reagent SYBR^® Green qPCR Master Mix (2x) (Applied Biosystems^®, CA, USA) using a 7500 Real Time PCR Cycler^® (Applied Biosystems^®, CA, USA).

Total RNA was isolated from undifferentiated NPCs using the ReliaPrep-Kit (Promega, Madison, WI, United States) according to the manufacturer’s protocol. Amount and purity of the isolated RNA was measured with a NanoDrop spectrophotometer ND-100 (Peqlab Biotechnologie GmbH, Erlangen, Germany). One microliter RNA was transcribed into cDNA with qScript cDNA SuperMix (Quantabio, Beverly, MA, United States) according to the manufacturers protocol. Primers were designed using Primer3web and synthesized by Microsynth (Balgach, Switzerland). Efficiency has been performed with serial dilution and an efficiency of 2.0 ± 0.15 was taken as sufficient. Primers are listed in Table 1. For quantification, cDNA was diluted 1:50. All experiments were done in a 7500 real-time PCR cycler (Applied Biosystems, Foster City, CA, United States) with SYBR Green Master Mix (Promega) according to the manufacturer’s protocol. Relative gene-expression was calculated as 2^–ΔΔCT values by normalizing to the house-keeping genes GAPDH and β-actin.

Differentially gene expression analysis was performed with DESeq2 v1.28.1 (Love et al., 2014 (link)) and the R statistical software version 4.0.2 (R.Core.Team, 2020 ). Most data manipulations were performed with functions of the R packages dplyr (Wickham et al., 2021 ) and matrixStats (Bengtsson, 2021 ). Minimal filtering was applied to exclude genes that had zero counts in all datasets. Paired analysis was performed to correct for donor-to-donor variation, and non-polarized M0 macrophages were included as controls. The differential gene expression analysis included Benjamini & Hochberg corrections and gene expression levels were considered significantly different when p_adjusted < 0.05. Genes were considered differentially expressed when log₂ fold change < -1 or > 1. An additional threshold of > 0.5 reads per kilo base per million mapped reads (RPKM) was used to only include substantially expressed genes in downstream analyses. The expression levels of a selected set of genes were validated by quantitative PCR (qPCR), using SYBR Green PCR Mastermix (Applied Biosystems) and a 7500 Real Time PCR Cycler (Applied Biosystems). Expression levels were normalized against the housekeeping gene TBP. ΔCt values of the selected genes and the used primers are shown in Supplementary Figure 1 and Supplementary Table 2, respectively.

MEFs were plated at 1 × 10⁵ cells/well in a six-well plate under different cholesterol conditions and allowed to adhere overnight. After the MEFs were infected with C. burnetii for 1 h in 500 µl medium, the wells were washed with PBS to remove extracellular bacteria and then gently scraped into 3 ml of medium. For the day 0 sample, 1 ml of the cell suspension was centrifuged at 20,000 × g for 10 min, and the pellet was frozen at −20°C. The remaining cells were left in the six-well plate in medium supplemented with cholesterol. The medium was changed daily to ensure constant cholesterol concentrations. At 6 days postinfection, the cells were harvested by scraping the cells into the growth medium and centrifuging at 20,000 × g for 10 min. Bacterial DNA was extracted from the pellets using the UltraClean microbial DNA isolation kit (Mo Bio Laboratories, Carlsbad, CA) according to the manufacturer’s instructions. Quantitative PCR for genome equivalents was performed using a primer set specific for dotA (30 (link)) and Luminaris Color HiGreen quantitative PCR (qPCR) master mix (Thermo Scientific) with an Applied Biosystems 7500 real-time PCR cycler. Each experiment was done in duplicate.