Sybr green pcr master mix of hairpin mirna rt pcr quantitation kit

Total RNA was extracted from tissues or cells using TRIzol (Invitrogen, Carlsbad, New Mexico, USA) in accordance with the manufacturer's instructions. RNA concentration was measured using NanoDrop2000c (Thermo Scientific, Wilmington, Delaware, USA). Quantitative reverse-transcription PCR (qRT-PCR) reactions for miR-455-5p were performed using the SYBR Green PCR Master Mix of Hairpin-miRNA RT-PCR Quantitation Kit (GenePharma, Shanghai, China) in accordance with the manufacturer's protocols as previously described [15 (link)].

Total RNA was extracted from tissues or cell lines using TRIzol reagent (Invitrogen), and cDNA was generated using random primers. Using the LightCycler 480 II Real‐Time PCR system (Roche Diagnostics, Basel, Switzerland), the level of miR‐195 was evaluated with SYBR Green PCR Master Mix of Hairpin‐miRNA RT‐PCR Quantitation Kit (GenePharma, Shanghai, China). Relative quantification of miR‐195 was analyzed using the 2-ΔΔCt method with U6 snRNA as endogenous control. The primer sequences used were as follows: miR‐195 forward: 5′‐ACACTCCAGCTGGGTAGCAGCACAGAAATATT‐3′, reverse: 5′‐CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCCAATA‐3′; U6 forward: 5′‐CTCGCTTCGGCAGCACA‐3′, reverse: 5′‐AACGCTTCACGAATTTGCGT‐3′; epithelial marker (E‐cadherin) forward: 5′‐CGAGAGCTACACGTTCACGG‐3′, reverse: 5′‐GGGTGTCGAGGGAAAAATAGG‐3′; mesenchymal marker (N‐cadherin) forward: 5′‐TCAGGCGTCTGTAGAGGCTT‐3′; reverse: 5′‐ATGCACATCCTTCGATAAGACTG‐3′; glyceraldehyde‐3 phosphate dehydrogenase forward: 5′‐GGAGCGAGATCCCTCCAAAAT‐3′, reverse: 5′‐A GGCTGTTGTCATACTTCTCATGG‐3′.