Pyromark q48 autoprep system
The PyroMark Q48 Autoprep System is a fully automated platform for DNA pyrosequencing analysis. It performs sample preparation, sequencing reaction setup, and pyrosequencing in a single integrated workflow. The system is designed to provide accurate and reliable results for a wide range of DNA sequencing applications.
Lab products found in correlation
12 protocols using pyromark q48 autoprep system
Bisulfite Pyrosequencing for DNA Methylation Analysis
Bisulfite Sequencing of CpG Islands
CpG island (c.502–613)−1: F-GTTAATTTGTTGTTGTAGGTTTAGTTG, R-biotin- AACTAAACCCCCATACCTACTTATA, and sequencing primer F-TGTTGTAGGTTTAGTTGT; CpG island (c.502–613)−2: F-biotin-GTTAATTTGTTGTTGTAGGTTTAGTTG, R-ACCACCCCCAATATAAAACAAATTCCC, and sequencing primer R-TCCCTCTACCAAACA; CpG sites (c.862 and 868): F-biotin-GAGGGGAGGTTGTTTGAGGA, R-ACCCTAAAATAACCATATACATACTCAT, and sequencing primer R-ATATACATACTCATAATATCCAAAA; and CpG sites (c.925 and c.1022): F-biotin-AGTATGTATATGGTTATTTTAGGGTTAAGT, R-biotin-AAATCCCAAACACTATACTCCTACCC, sequencing primer 1-F-TTATTTTAGGGTTAAGTAGTTTTTA, and sequencing primer 2-F-AGAGGAAAGTTAGAAGAG. PCR products were subjected to pyrosequence using the PyroMark Q48 Autoprep system (Qiagen) and were analyzed using PyroMark Q48 Autoprep 2.4.2 software (Qiagen) [22 (link)].
Quantifying Cytosine Methylation in TNF Exon 1
PCR product was used for CpG quantification with the PyroMark Q48 Autoprep (Qiagen) using Advanced CpG Reagents (Qiagen) in accordance with the manufacturer's protocol. The assay covered the methylation sites +197, +202, +214 and +222 base pairs from the transcription start site of TNF. In this manuscript, these sites are designated as CpG1 to CpG4 for data analysis and inferences. The percentage methylation of the four CpG sites was calculated within the software (PyroMark Q48 Autoprep 2.4.1 Software, Qiagen) and the methylation percentages were exported for further analysis.
Quantifying DNA Methylation via Bisulfite Pyrosequencing
PARP4 Gene Methylation Analysis
Genomic DNA Methylation Analysis
Methylation Assessment of SLC6A3 Gene
Bisulfite Conversion and Pyrosequencing
Bisulfite Pyrosequencing of CGI Regions
Global DNA Methylation Quantification
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!