5 pmol of IVT RNA was added up to 4.5 μL with nuclease-free water, and 1 μL of 5 μM Cy5-labelled DNA primer was subsequently added. 3 μL reverse transcription buffer was added to give a final concentration of 150 mM LiCl/KCl, 4 mM MgCl2, 20 mM Tris pH 7.5, 1 mM DTT, and 0.5 mM dNTPs. The mixture was first heated to 75 °C for 3 min and then 35 °C for 5 min and 0.5 μL of Superscript III (200 U μL–1) (Thermo Fisher Scientific, USA) was added to make up the 10 μL reaction mixture. The reverse transcription was maintained at 50 °C for 15 min, and then 0.5 μL of 2 M NaOH was added at the end of the step. The temperature was immediately ramped up to 95 °C for 10 min. Finally, 10 μL of home-made 2× denaturing formamide dye was added to the reaction mixture.36 cDNAs were size fractionated using 8 M urea 8% denaturing polyacrylamide gel. The gel was scanned with Fujifilm FLA-9000.
Fla 9000
Manufactured by Fujifilm
Sourced in Japan
The FLA-9000 is a fluorescence imaging system designed for life science applications. It utilizes a high-sensitivity CCD camera and multiple excitation light sources to capture fluorescent signals from a variety of samples. The system provides quantitative analysis capabilities and supports a range of sample types, including gels, membranes, and microplates.
Automatically generated - may contain errors
Lab products found in correlation
Superscript 3, by Thermo Fisher Scientific (3 mentions)
Ruby general protein stain, by Fujifilm (2 mentions)
Bis tris native page, by Thermo Fisher Scientific (2 mentions)
Sybr gold stain, by Thermo Fisher Scientific (2 mentions)
Multigauge, by GE Healthcare (2 mentions)
Hybond xl nylon membrane, by GE Healthcare (2 mentions)
Emsa gel shift binding buffer, by Beyotime (2 mentions)
Ultrahyb oligo hybridization buffer, by Thermo Fisher Scientific (1 mentions)
Hybond n membrane, by GE Healthcare (1 mentions)
Multi gauge v3, by Fujifilm (1 mentions)
Multi gauge software, by Fujifilm (1 mentions)
Uracil dna glycosylase, by New England Biolabs (1 mentions)
Trans blot sd semidry transfer apparatus, by Bio-Rad (1 mentions)
T4 polynucleotide kinase, by Thermo Fisher Scientific (1 mentions)
Hybond n, by GE Healthcare (1 mentions)
Rapid hyb buffer, by GE Healthcare (1 mentions)
G 25 column, by GE Healthcare (1 mentions)
Imagegauge 3, by Fujifilm (1 mentions)
Igor pro 6, by Wavemetrics (1 mentions)
Blue dextran, by Merck Group (1 mentions)
43 protocols using fla 9000
1
Reverse Transcription and cDNA Fractionation
2
RNA Sequencing with Cy5-Labeled Primers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
NAI-modified or untreated RNA was added up to 5.5 μL with nuclease-free water, and 1 μL of 5 μM Cy5-labelled DNA primer was then added. 3 μL of reverse transcription buffer was added to give a final concentration of 150 mM LiCl, 4 mM MgCl2, 20 mM Tris–HCl pH 7.5, 1 mM DTT, and 0.5 mM dNTPs. For dideoxy sequencing, 1 μL of 10 mM corresponding ddNTP was added to replace 1 μL of nuclease-free water. The mixture was heated at 75 °C for 3 min, followed by 35 °C for 5 min. Next, the 9.5 μL mixture was heated up to 50 °C, and 0.5 μL of Superscript III (200 U μL–1) (Thermo Fisher Scientific, USA) was added to make up the 10 μL reaction mixture. The reverse transcription was performed at 50 °C for 15 min, and then 0.5 μL of 2 M NaOH was added. The temperature was immediately raised to 95 °C for 10 min. Finally, 10 μL of home-made 2× denaturing formamide dye was added to the reaction mixture.18 The cDNAs were size fractionated using 8 M urea 8% denaturing polyacrylamide gel. The gel was scanned with Fujifilm FLA-9000.
3
Clickable Antibody Glycan Modification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 9
Monoclonal antibody anti-TSH was modified at its GlcNAc sites with UDPGalNAz using galactoyltransferase. The GalNAz groups were then click reacted either with the standard click reaction using BCS, with DIBO click reaction or with THPTA/Picolyl click reaction. Cu 2 mM is the original Cu Click reaction with 2 mM Cu+10 mM Ascorbate for 4 min, followed by addition of 10 mM BCS with incubation for 30 min. THPTA/Picolyl click reactions were carried out with 0.25 mM Cu, supplemented with THPTA at a molar ratio of 0:1, 1:1, 2:1, 4:1, and 8:1 for 40 minutes in the presence of 10 mM ascorbate. For all Cu containing reactions 10 μM picolyl Oregon green alkyne was used. DIBO click reactions were carried out with DIBO-Oregon Green 488 at 20 μM for 3 h. In
4
Optimizing Antibody Conjugation Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 9
Monoclonal antibody anti-TSH was modified at its GlcNAc sites with UDPGalNAz using galactoyltransferase. The GalNAz groups were then click reacted either with the standard click reaction using BCS, with DIBO click reaction or with THPTA/Picolyl click reaction. Cu 2 mM is the original Cu Click reaction with 2 mM Cu+10 mM Ascorbate for 4 mM, followed by addition of 10 mM BCS with incubation for 30 mM. THPTA/Picolyl click reactions were carried out with 0.25 mM Cu, supplemented with THPTA at a molar ratio of 0:1, 1:1, 2:1, 4:1, and 8:1 for 40 minutes in the presence of 10 mM ascorbate. For all Cu containing reactions 10 μM picolyl Oregon green alkyne was used. DIBO click reactions were carried out with DIBO-Oregon Green 488 at 20 μM for 3 h. In
5
RNA Binding Protein Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cy3‐labelled RNA probes [wild‐type (WT) probe: UAAUUCGUACUUUUUUUUUCUUUUCUUUUAUAGUGUGAA; mutant probe: UAAUUCGUACTTGCTTCCTCTTTACTTGTAUAGUGUGAA] were synthesis by Shanghai Generay Biotech Company. Recombinant Msi2, HuR, or the combination of Msi2 and HuR were incubated with Cy3‐labelled RNA in binding buffer containing 100 mM Tris–HCl, pH 7.5, 7.5 mM KCl, 25 mM MgCl2, 375 mM NaCl, 12.5% glycerol and 5 mM DTT at 30°C for 30 min, respectively. RNA‐protein complexes were fractionated by a 6% non‐denaturing polyacrylamide gel at 120 V for 35 min, at 4°C, and visualized with a FUJIFILM FLA9000 image scanner.
6
Fluorescent RNA/DNA Polymerase Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both strands of the primer-template substrate (see Table 1 ) were annealed in reaction buffer by the following temperature program: 98°C for 2 min, 70°C for 5 min, 50°C for 10 min, 40°C for 5 min, 25°C for 30 min. Reaction mixtures contained 1.0 μM enzyme, 100 nM primer-template substrate and 100 μM of the relevant rNTPs (or dNTPs) in 25 mM Tris/HCl pH 6.5, 10 mM MnCl2, 1 mM DTT. The polymerase assay was performed in a total volume of 10 μl. Reaction mixtures were incubated for 60 min at 50°C and the enzymatic reaction quenched by adding an equal volume of 20 mM EDTA, 0.25% (w/v) bromophenol and 0.25% (w/v) xylene cyanol in 95% (v/v) formamide. After heat treatment (90°C, 3 min), 10 μl of the reaction mixture was loaded onto 20% denaturing urea polyacrylamide gels (10 mM Tris/HCl pH 7.6, 10 mM boric acid, 200 μM ethylenediaminetetraacetic acid (EDTA), 7 M urea, acrylamide/bis (19:1)) and fluorescence images of the separated reaction products taken with an Fujifilm FLA-9000 image scanner. In case of the incorporation of 5-propargylamino-CTP-6-FAM (FAM-CTP), the rNTP composition was optimized to 100 μM ATP/GTP/UTP, 20 μM CTP and 1 μM FAM-CTP to achieve an efficient fluorophore incorporation. Likewise, in case of labelled UTP (5-(3-Aminoallyl)-UTP-6-FAM) the concentrations were adjusted as follows: 100 μM ATP/CTP/GTP, 20 μM UTP and 1 μM FAM-UTP.
7
Northern Blot Analysis of Total RNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was resolved on 10% denaturing polyacrylamide gel and transferred to Hybond‐N+ membrane (GE Healthcare) by electroblotting (Bio‐Rad). The hybridization with radioactively labeled oligonucleotides was performed in ULTRAhyb‐oligo hybridization buffer (Ambion) at 38°C. Prior to addition of the labeled probe, the membrane was prehybridized at 42°C for 2 h. The radioactive signal was monitored by phosphorimager FLA‐9000 (FUJIFILM). Quantification of signals was done using Multi Gauge software v3.2 (FUJIFILM).
8
Native Gel Binding Assay for RNA-Protein
9
Nuclease Assays for Mus81 and Rad27 Complexes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nuclease assays were performed as previously described [18 (link)]. Briefly, reactions containing purified Mus81 complex were performed with 5 nM DNA substrate in buffer N (20 mM Tris–HCl (pH 7.5), 0.2 mM DTT, 10 mM MgCl2, and 5% glycerol). For the human MUS81-EME1 complex, the buffer used contained 50 mM Tris–HCl (pH 7.5), 5 mM MgCl2, 1 mM DTT, and 100 μg/mL BSA. After incubation for 20 min at 37 °C, the reaction was stopped by addition of 0.1% SDS and 500 μg/mL of proteinase K and additional incubation for 5 min at 37 °C. The reactions were mixed with 1/10 volume of loading buffer (60% glycerol, 10 mM Tris-HCl (pH 7.4), 60 mM EDTA, and 0.1% Orange G). The fluorescent DNA was visualized by FLA-9000 (Fuji) and quantified using Multi-Gauge V3.2 (Fuji) software. Rad27 reactions were performed as described above, except that the buffer contained 50 mM Tris–HCl (pH 7.5), 1 mM DTT, and 5 mM MgCl2.
In the Mus81 complex targeting assay, 4 nM 3′ flap substrate and 0.25 nM ΦX174 virion circular ssDNA were mixed in N buffer together with 0.4 nM Mus81-Mms4 and increasing concentrations of RFC (5, 12.5, 25, 50 nM). The mixture was incubated at 37 °C for 30 min and analyzed as described above.
In the Mus81 complex targeting assay, 4 nM 3′ flap substrate and 0.25 nM ΦX174 virion circular ssDNA were mixed in N buffer together with 0.4 nM Mus81-Mms4 and increasing concentrations of RFC (5, 12.5, 25, 50 nM). The mixture was incubated at 37 °C for 30 min and analyzed as described above.
10
Autoradiography of Radioactive Plankton
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To survey possible highly radioactive particles that may have been in the plankton samples, autoradiography was applied to dried zooplankton samples collected at stn. G4 in August 2012 and at stn. J1 in May 2012, which had higher 137Cs concentrations than the rest of the samples collected at each station. The samples were spread in plastic zipper bags. An imaging plate (Fujifilm FLA-9000) in contact with the bagged sample was placed in a space shielded with lead blocks and exposed for 24 h for the G4 sample and for 19 h for the J1 sample.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!