G2025

Manufactured by Merck Group

Sourced in Japan

The G2025 is a laboratory equipment product from Merck Group. It is designed for precise liquid handling and sample preparation tasks. The core function of the G2025 is to accurately dispense and transfer small volumes of liquids in a controlled and repeatable manner.

Automatically generated - may contain errors

Lab products found in correlation

7 protocols using g2025

Dual Fluorescent Staining of Blastocysts

Check if the same lab product or an alternative is used in the 5 most similar protocols

For TE cell staining, solution 1 was prepared by mixing 100 µg/mL of propidium iodide (P-4170, Sigma) and 1% Triton X-100 (T-93443, Sigma) in Ham's F-10 solution. Solution 2 was a mixture of 25 µg of bisbenzimide (B-2261, Sigma) in 99.9% ethanol, which was prepared to stain the ICM. In order to carry out double-fluorescence staining, the blastocysts were stained in solution 1 for 10 seconds and transferred to solution 2 for 2 hours or more at 4℃. The stained blastocysts were washed with glycerol (G2025, Sigma) and put onto a slide glass for observation under a fluorescence microscope.

Kim H.J., Park S.B., Yang J.B., Choi Y.B, & Lee K.H. (2017). Effects of laser-assisted hatching and exposure time to vitrification solution on mouse embryo development. Clinical and Experimental Reproductive Medicine, 44(4), 193-200.

+ Open protocol

+ Expand

Dual Immunostaining of Blastocyst Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols

Double immunofluorescence staining of the embryo was performed using the protocol described by Park et al. [22 ]. In brief, following a 72 hours incubation period, solution 1 (a mixture of Ham's F-10, 1% Triton X-100 [T9254, Sigma], and 100 µg/mL propidium iodide [P4170, Sigma]) and solution 2 (a mixture of 99.9% ethanol [Merck, Germany], 25 µg bisbenzimide [B2883, Sigma]) were used for staining. The blastocyst embryo was stained following exposure to solution 1 for 15 second, and to solution 2 in 4℃ atmosphere for 2 hours. The stained blastocyst was washed in glycerol (G2025, Sigma) and transferred to a slide glass for inspection under a fluorescent microscope (BX50, Olympus, Tokyo, Japan) (Figure 1C).

Park S.B., Kim H.J., Choi Y.B., Ahn K.H., Lee K.H., Yang J.B., Yu C.S, & Seo B.B. (2014). The effect of various assisted hatching techniques on the mouse early embryo development. Clinical and Experimental Reproductive Medicine, 41(2), 68-74.

+ Open protocol

+ Expand

Ethyl Palmitate Pretreatment Attenuates LPS-Induced Inflammation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Eight-week-old C57BL/6N male mice were purchased from Orient Bio (Seongnam, Korea). All experiments using mice were performed in accordance with the guidelines of the Public Health Service Policy in Humane Care and Use of Laboratory Animals. The protocol was approved by the Institutional Animal Care and Use Committee (IACUC) of the Department of Laboratory Animal Resources of Soonchunhyang Institute of Medi-bio Science. Ethyl palmitate (Tokyo Chemical Industry, P0003) was dissolved in water with 4.8% lecithin (FUJIFILM Wako Pure Chemical Corporation, 120-00832) and 10% glycerol (Sigma-Aldrich, G2025) to make a mixture containing Ethyl palmitate at a concentration of 300 mM. LPS (Sigma-Aldrich, E. coli O55:B5) was dissolved in PBS, and 0.025 mg/kg LPS was injected intraperitoneally into mice. Dantrolene and DUB were dissolved in DMSO and diluted with PBS. For in vivo administration, dantrolene (10 mg/kg), DUB (5 mg/kg) or DMSO solution diluted in PBS was injected into mice that were fasted for 24 h. After 1 h, 300 mM Ethyl palmitate or vehicle was administered, followed by LPS injection 1 h later. Blood and liver tissue samples were obtained 24 h later.

Oh S.J., Hwang Y., Hur K.Y, & Lee M.S. (2023). Lysosomal Ca2+ as a mediator of palmitate-induced lipotoxicity. Cell Death Discovery, 9, 100.

+ Open protocol

+ Expand

CRISPR Genome Editing in CD34+ HSPCs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Electroporation was performed using Lonza 4D Nucleofector (V4XP-3032 for 20 μl as the manufacturer’s instructions). CD34+ HSPCs were thawed 24 h before electroporation. For 20 μl Nucleocuvette Strips, the RNP complex was prepared by mixing 3xNLS-SpCas9 protein^{7 (link)} (100 pmol) or HiFi-3xNLS-SpCas9 protein (100 pmol) and sgRNA-1617: CTAACAGTTGCTTTTATCAC (300 pmol, IDT) with glycerol (2% of final concentration, Sigma, G2025) and P3 solution up to 10 μl and incubating for 15 min at room temperature immediately before electroporation. 50K HSPCs resuspended in 10 μl P3 solution were mixed with RNP and transferred to a cuvette for electroporation with program EO-100. The P3 solution was removed after 15 min of room temperature rest. The electroporated cells were resuspended with SCGM medium with cytokines and changed into EDM 24 h after electroporation.

Cancellieri S., Zeng J., Lin L.Y., Tognon M., Nguyen M.A., Lin J., Bombieri N., Maitland S.A., Ciuculescu M.F., Katta V., Tsai S.Q., Armant M., Wolfe S.A., Giugno R., Bauer D.E, & Pinello L. (2022). Human genetic diversity alters off-target outcomes of therapeutic gene editing. Nature genetics, 55(1), 34-43.

+ Open protocol

+ Expand

Inhibition of Mtb Biofilm Formation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The effect of ITD-13 on biofilm formation was examined for the Mtb H37Rv strain by performing biofilm assays in the absence and presence of the compound (MIC₅₀ and MIC₉₀). Growth of Mtb biofilms was determined in Sauton’s medium [0.5 g of KH₂PO₄, 0.5 g of MgSO₄ (M7506, Sigma), 4 g of L-asparagine (A4159, Sigma), 2 g of citric acid (C2404, Sigma), 0.05 g of ferric ammonium citrate (F5879, Sigma), 60 mL of glycerol (G2025, Sigma), and 900 mL of deionized water, pH 7.0 in 24-well plates, as previously described with some modifications [19 (link)]. Immediately before the experiment, sterile ZnSO₄ (Z0251, Sigma) was added to a final concentration of 0.1% w/v. Briefly, H37Rv was cultured to OD₆₀₀ = 1 in 7H9 medium supplemented with 10% OADC and 0.05% Tween 80. Next, the inoculum was added at a ratio of 1:100 v/v to Sauton’s medium, and then the obtained mixture was dispensed into each well of a 24-well plate (2.5 mL/well). The plate was covered with a lid, carefully wrapped with parafilm, and further incubated undisturbed in a humidified microbiological incubator at 37 °C for 5 weeks.

Bekier A., Kawka M., Lach J., Dziadek J., Paneth A., Gatkowska J., Dzitko K, & Dziadek B. (2021). Imidazole-Thiosemicarbazide Derivatives as Potent Anti-Mycobacterium tuberculosis Compounds with Antibiofilm Activity. Cells, 10(12), 3476.

+ Open protocol

+ Expand

Dual Fluorescence Staining of Blastocysts

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to stain the TE cells, solution 1 was prepared by mixing 100 µg/mL of propidium iodide (P-4170, Sigma) and 1% Triton X-100 (T-93443, Sigma) in Ham's F-10 solution. Solution 2 was a mixture of 25 µg of bisbenzimide (B-2261, Sigma) in 99.9% ethanol, which was prepared to stain the ICM. In order to carry out double fluorescence staining, the blastocysts were stained in solution 1 for 10 seconds and transferred to solution 2 for 2 hours or more at 4℃. The stained blastocysts were washed with glycerol (G2025, Sigma) and put onto a slide glass for observation under a fluorescence microscope (BX50, Olympus, Japan) (Figure 2).

Kim H.J., Lee K.H., Park S.B., Choi Y.B, & Yang J.B. (2015). The effect of artificial shrinkage and assisted hatching on the development of mouse blastocysts and cell number after vitrification. Clinical and Experimental Reproductive Medicine, 42(3), 94-100.

+ Open protocol

+ Expand

Characterizing Dynamic Properties of Tissue Phantoms

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to demonstrate that SCOS is capable of retrieving the dynamic properties of a medium, we have performed measurements in tissue simulating phantoms in a similar fashion as previous DCS experiments [16 (link), 17 ]. The primary phantom consists of a 1% solution of Lipofundin® MCT/LCT 20% (B.Braun, Spain) in water with μ_a = 0.026cm⁻¹,

μ_{s}^{'}

= 6.31 cm⁻¹ and D_B = (1.95 ± 0.05) × 10⁻⁸ cm²/s. Another phantom with a reduced D_B is prepared with an increased viscosity consisting of 50% glycerol (G2025, Sigma-Aldrich, Spain)- 50% Lipofundin® MCT/LCT (20%) with μ_a = 0.02 cm⁻¹,

μ_{s}^{'}

= 9.72 cm⁻¹ and D_B = (6.93 ± 0.39) × 10⁻¹⁰ cm²/s. The optical properties of the phantoms were independently measured using time resolved spectroscopy (TRS) and the D_B value by DCS. From this point on, we denote these phantoms as Lipofundin phantom and glycerol phantom respectively.
First we present an experiment in transmission geometry where the two liquid phantoms presented above were studied using the speckle contrast measurement made at multiple source-detector separations at a given exposure time. Subsequently, the Lipofundin phantom is studied using the speckle contrast measurement made at different exposure times for a given source-detector separation in the re-emission geometry.

Valdes C.P., Varma H.M., Kristoffersen A.K., Dragojevic T., Culver J.P, & Durduran T. (2014). Speckle contrast optical spectroscopy, a non-invasive, diffuse optical method for measuring microvascular blood flow in tissue. Biomedical Optics Express, 5(8), 2769-2784.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!