Pcdna3.1 v5

The cDNA encoding full-length human Id4 (GeneBankTM accession number NM_001546.3), and Slug (NM_003068.4) and its deletion mutants, were PCR-amplified. Then, the expression plasmids produced were transferred by ligation PCR-generated inserts into pcDNA3.1/V5-His-TOPO (Invitrogen) and pFlag-CMV-2 (Sigma-Aldrich) vectors. To establish CL1-5/Id4-overexpressing or vector control stable cells, purified pcDNA3.1-V5-Id4 or pcDNA3.1-V5-His-TOPO plasmids were transfected into 70% confluent CL1-5 cells using Lipofectamine2000 transfection reagents (Invitrogen) in a total volume of 1 mL Opti-MEM (Invitrogen), as previously described [7 (link)]. Then, Geneticin (G418; Merck, Darmstadt, Germany) was added at a concentration of 600 ug/mL to select for a pooled population of stable transfectants, and the selection medium was changed every 3 d for another 3 weeks. Clones of resistant cells were isolated and allowed to expand for further characterization.

NSC34 cells were transfected with vectors encoding mouse Pacer-V5 or empty vector (pcDNA3.1/V5) (Invitrogen) or with vectors targeting mouse Pacer mRNA, shPacer A (GGACACAGAAGACGCCAGCAGGTTACGTG), shPacer B (TGGTACAACGGCCATTGGAGAGCTGTGTT) or a scramble control vector (shCtrl) (OriGene). To induce autophagy cells were treated with rapamycin (200 nM, Enzo Life Sciences, BML-A275) for 6 h. For the autophagy flux, cells were washed once with PBS and maintained with EBSS (Gibco, 24,010,043) medium for 0.5, 2, or 4 h. To inhibit autophagosome-lysosome fusion, cells were treated with a mix of bafilomycin A₁ (0.5 μM), and protease inhibitors pepstatin (10 μg/ml), and E64D (10 μg/ml) for 4 h, all purchased from Merck.

The HEK 293T (293T) cells and knockout 293T cells generated through the CRISPR/Cas9 system were cultured in Dulbecco’s modified Eagle’s medium (Sigma-Aldrich) with 10% (v/v) fetal bovine serum (FBS, Gibco) and 1% Penicillin-Streptomycin antibiotics (Gibco) at 37°C and 5% CO₂.
Lipofectamine^TM 2000 transfection reagent (Invitrogen) was used for transient transfection of plasmids according to the manufacturer’s protocol. Expression plasmids used in this study were: MIEF1-V5, MIEF2-V5, and MIEF1/2 deletion mutants tagged by V5/His at the C-terminus including MIEF1^Δ1-48, MIEF1^Δ50-108, MIEF1^Δ109-154, MIEF1^Δ173-216, MIEF1^Δ219-289, MIEF1^Δ296-337, MIEF1^Δ341-463, MIEF1^Δ345-380, MIEF1^Δ385-425, MIEF1^Δ431-463, MIEF1^Δ380-463, MIEF2^Δ1-49, MIEF2^Δ122-132, MIEF2^Δ151-160, MIEF2^Δ235-250, MIEF2^Δ265-275 and MIEF2^Δ425-454 [25 (link), 26 (link), 29 (link)], Myc-hFis1[45 (link)], and pcDNA3.1-V5/His empty vector. MIEF2^Δ50-104 was generated by PCR and cloning into pcDNA3.1-V5 (Invitrogen). To avoid the side effect of overexpression, cells were transiently transfected with only 0.3–0.5 μg of expression plasmids for 15–17 h and harvested for further analysis.