Quantitative RT-PCR was performed with the SYBR Green JumpStart Taq ReadyMix Kit (Sigma-Aldrich, Taufkirchen, Germany; RotorGene RG-3000, Qiagen, Hilden, Germany). All samples were run in duplicates. Β-Actin was used for normalization (Table 2 ).
Sybr green jumpstart taq readymix kit
Manufactured by Merck Group
Sourced in United States, Germany
The SYBR Green JumpStart Taq ReadyMix kit is a ready-to-use solution for real-time PCR analysis. It contains the necessary components, including SYBR Green I dye, Taq DNA polymerase, and optimized buffer, to perform quantitative PCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
Rotor gene rg 3000, by Qiagen (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Tri reagent, by Merck Group (1 mentions)
Omniscript rt kit, by Qiagen (1 mentions)
Mx3000p qpcr cycler, by Agilent Technologies (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
Taqman universal pcr master mix, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
High capacity cdna rt kit, by Thermo Fisher Scientific (1 mentions)
Rnase free dnase kit, by Promega (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Stratagene mx3005p real time pcr machine, by Agilent Technologies (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Superscript 2, by Thermo Fisher Scientific (1 mentions)
Icycler, by Bio-Rad (1 mentions)
Rneasy plus mini kit, by Qiagen (1 mentions)
Genomic mini purification kit, by A&A Biotechnology (1 mentions)
7500 apparatus, by Thermo Fisher Scientific (1 mentions)
10 protocols using sybr green jumpstart taq readymix kit
1
SYBR Green qRT-PCR for Gene Expression
2
RNA Isolation and Real-time PCR
3
Gene Expression Analysis in Murine Liver
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
12 hr after injection with ConA, mice were euthanized and liver tissues were harvested, and used for total RNA extraction with TRIzol reagent (Invitrogen, Carlsbad, CA, USA). After synthesizing cDNA from the RNA samples, cDNA samples were subjected to quantitative real-time polymerase chain reaction (qRT-PCR) using the TaqManTM Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and TaqManTM Gene Expression Assays (Applied Biosystems) following the manufacturers' instructions. QRT-PCR analysis was conducted in a Light Cycler quantitative PCR apparatus (Stratagene, Santa Clara, CA, USA) using the SYBR Green JumpStart Taq ReadyMix kit (Sigma-Aldrich). The expression value was normalized to β-actin in the same sample. The primers used in the PCR reactions, including those for mouse Il6, Il12a, Il10, Tnf, Ifng, and Actb and for human IL-6, IL-12A, IL10, TNF, IFNG and ACTB (Supplementary Table 1 ) were synthesized by Sangon Biotech (Shanghai, China).
4
Hesperidin Extraction and RNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hesperidin was obtained from TCI Chemicals, Japan. PTZ, SYBR green jumpstart Taq Ready mix kit, and Trizol reagent procured from Sigma Aldrich, United States. Applied Biosystems, United States provided High capacity cDNA-RT kit. Whereas, RNase-free DNase kit was procured from Promega, Madison, United States. Sea salt was obtained from Aquarium Systems, Germany.
5
Quantitative Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from mouse tissues using TRIzol (Invitrogen) according to the manufacturer’s instructions. The RNA was subjected to reverse transcription with random hexamer primer and M-MLV Reverse Transcriptase (Progema). Real-time PCR was conducted in the LightCycler quantitative PCR apparatus (Stratagene) using the SYBR Green JumpStart™ Taq ReadyMix™ kit (Sigma). Expression values were normalized to β-Actin. The primer pairs used are as follows: CysLT1 sense- CTCCAAGGCACCAAGCAGAC, CysLT1 anti-sense- TGCCAAAGAAACCCACAACAG; 5-LO sense- CACGCATCTGGTGTCTGAGG, 5-LO anti-sense- CCTTAGTGTTGATAGCAATGGTGA; cPLA2α sense- GACAGCAGGAAGCGAACGAGAC, cPLA2α anti-sense-CGTAGTTGGCATCCATCAGTGTGA, LTC4S sense- CCTGTGCGGACTGTTCTACCT, LTC4S anti-sense- GCCATCGCCACCAGCA; β-actin sense- GGCTGTATTCCCCTCCATCG, β-actin anti-sense- CCAGTTGGTAACAATGCCATGTT; IL-17A sense- TTAACTCCCTTGGCGCAAAA; IL-17A antisense- CTTTCCCTCCGCATTGACAC; TGF-β sense-CTCCCGTGGCTTCTAGTGCT; TGF-β antisense-AGCCTTAGTTTGGACAGGATCTG; IFN-γ sense- ACAATGAACGCTACACACTGCAT; IFN-γ antisense-CCTTTTGCCAGTTCCTCCAG; IL-1βsense- AAGCCTCGTGCTGTCGGA; IL-1βantisense-CAGGGTGGGTGTGCCGT
6
Semi-quantitative RT-PCR of En2 and β-Actin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Semi-quantitative RT-PCR was performed using the Stratagene MX3005P Real Time PCR machine (Agilent Technologies, UK), measuring PCR product accumulation during the exponential phase of the reaction by SYBR green fluorescence (SYBR® Green JumpStart™ Taq ReadyMix™ Kit, Sigma-Aldrich, UK). Reaction conditions were 1 cycle of 94 °C for 10 min, 40 cycles of 30 s at 94 °C, and 1 min at 60 °C and 30 s at 72 °C. The forward and reverse primers for En2 were 5′ GAACCCGAACAAAGAGGACA 3′ and 5′ CGCTTGTTCTGGAACCAAAT 3′, and for ß-actin were 5′ ATGTA CCCTGGCATTGCCGACA 3′ and 5′ GACTCGTCATACTCCTGCTTGT 3′. Relative expression was calculated using the ∆CT comparative method (2-∆Ct) [15 (link), 18 (link)], and expression is shown relative to ß-actin (× 100,000).
7
Quantification of miRNA Expression by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The TRIzol reagent (Takara Bio, Inc., Otsu, Japan) was used to isolate total RNA. Next, cDNA was synthesized and amplified using the SYBR® PrimeScript™ RT Master Mix kit (Takara Bio, Inc.) and the ABI PRISM 500 Sequence Detection System (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The thermocycling conditions for reverse transcription was as follows: 37°C 15 min, 85°C 5 sec, and 4°C for storage. The gene used for normalization was Hsa-U6 small nuclear RNA (snRNA). The primers used were as follows: 5′-CGCGCGTGAATTACCGAAG-3′ (forward) and 5′-GTGCAGGGTCCGAGGT-3′ (reverse) for miR-449b-3p; 5′-CGCGCTATGGCACTGGTAG-3′ (forward) and 5′-GTGCAGGGTCCGAGGT-3′ (reverse) for miR-449b-5p; 5′-GCGCGTCGTGAAGCGTTC-3′ (forward) and 5′-GTGCAGGGTCCGAGGT-3′ (reverse) for Hsa-U6 snRNA. The conditions for qPCR were determined according to the protocol of the SYBR-Green JumpStart Taq ReadyMix kit (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). qPCR was implemented on a 7300 Real-Time PCR Detection System (ABI). The incubation condition for qPCR was as follows: Stage 1 (95°C 30 sec); stage 2 (40 cycle, 95°C 5 sec; 60°C 31 sec); stage 3 (95°C 15 sec; 60°C 1 min; 95°C 15 sec). The results were expressed as arbitrary units defined by the 2−ΔΔCt method (7 (link)).
8
Quantification of Toca-1 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extraction was done using the RNeasy Plus Mini Kit (Qiagen) according to the manufacturer’s instructions. cDNA synthesis was performed with random hexamer primers and Superscript II reverse transcriptase (Invitrogen, Waltham, MA, USA). qRT-PCR was performed on cDNA using human Toca-1 primers (for 5′ CAAACCAGGAAGTCCGTGGGCC 3′; Rev 5′ ATGTCACACATGGCACAAAGGTGC 3′) and GAPDH primers (for 5′ GCCTTCCGTGTCCCCACTGC 3′; Rev 5′ CAATGCCAGCCCCAGCGTCA 3′) and SYBR Green JumpStart Taq ReadyMix kit (Sigma-Aldrich; 58°C annealing, 40 cycles, BioRad iCycler (BioRad Laboratories, Hercules, CA, USA). Transcript levels were analyzed using the 2-ΔΔCT method [20 (link)]. Toca-1 mRNA levels were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA levels.
9
Plasmid Copy Number Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The copy number of pRK415 and its derivatives was measured by qPCR using the SYBR® Green JumpStart™ Taq ReadyMix kit (Sigma). The single-copy galK, gene from E. coli chromosome, was used as the chromosomal reference gene (primers #26 and #27) for all strains. The trfA gene of RK2 was used as the plasmid reference gene (primers #28 and #29) for pRK415 derivatives and pMPB9.90 (araBADp-trfARK2) whereas repB gene was amplified for plasmid RA3 (primers #30 and #31) (Table 2 ). Total DNA was purified from 4 ml of stationary-phase cultures using Genomic Mini purification kit (A&A Biotechnology), treated with an appropriate restriction enzyme to linearize the plasmid DNA and to fragment chromosomal DNA and then used as a template in qPCR. Plasmid copy number (PCN) was calculated relatively to the chromosomal marker on the basis of at least three biological replicates with three technical replicates per strain and average results with standard deviation are reported. The amplification, detection and analysis were carried out in the Laboratory of Genetic Modification Analyses of IBB PAS on an Applied Biosystems 7500 apparatus.
10
Quantifying Gene Expression in Brain Tumors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR primers were designed using Primer 3 software (http://frodo.wi.mit.edu/primer3/ ) (Additional file 5 : Table S5). RT-qPCR was used to quantify the levels of mRNA expression for selected genes, using SYBR Green JumpStart Taq ReadyMix kit (Sigma-Aldrich), 50 ng cDNA, and 0.1 μM primers in a reaction volume of 20 μl. Assays were run on an ABI 7500 Real Time PCR System (ABI). PCR analyses were conducted in triplicate for each sample and melting curves analyzed for correct product size. Control genes TBP and CREB1 were tested for stability over all tumors, and TBP selected as the most stable endogenous control. Therefore, all samples were normalized to TBP and fold change calculated relative to the average expression in adult cerebellum (BioChain, A508112), and frontal lobe (BioChain B210079). Relative quantification was calculated using the 2-ddCt method [35 (link)].
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!