Abi prism 7700 sequence detection system

The Girdin amplification primer sequence was downloaded from NCBI and Primer5.0 software was used to design primers. The primer sequences of Girdin were as follows: forward 5′-GACCAACTAGAGGGAACTCG-3′ and reverse 5′-TACTTTGT TTCTGTGCCATT-3′. The primer sequences of β-actin sense strand was: AGGGGCCGGACTCGTCATACT and the anti-sense strand was: GGCGGCACCACCA TGTACCCT. Both miR-101 (HmiRQP0020) and U6 (HmiRQP9001) primers were purchased from Guangzhou Fulengen Co., Ltd. (China). TRIzol method (Invitrogen) was used to extract the total RNA of cells and tissues. The purity and integrity of RNA was examined on a Micro-UV Spectrophotometer and RNA electrophoresis. Total RNAs was reverse- transcribed into cDNA with miScript II RT Kit (Qiagen, USA) on an ABI-9600 PCR Amplifier (PerkinElmer) detected by ABI PRISM 7700 Sequence Detection System (PerkinElmer). Samples were compared by using the relative expression level was calculated via the 2^−ΔΔCT method. Girdin mRNA expression level was normalized to β-actin, while miR-101 expression level was normalized to U6.

Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. RNA concentrations were determined by an ultraviolet spectrophotometer (SHIMADZU UV-2450; Shimadzu Corporation, Kyots, Japan). Subsequently, 2 μg of total RNA was reverse transcribed to produce single-stranded DNA using Super-Script II (Thermo Fisher Scientific). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using the ABI Prism 7700 Sequence Detection System (PerkinElmer Inc., Waltham, MA, USA). The primer sequences were: 5′-AGCAACTTGGACAGCAACAG-3′ (forward) and 5′-TCTTCCTGGGCTGCTTATCT-3′ (reverse) for S100A4; 5′-AGGCCTTGGAACTCAAGGAT-3′ (forward) and 5′-CCCTTTTTGGACTTCAGGTG-3′ (reverse) for p53; 5′-CCAAAGCCTCAGGTCATAAACA-3′ (forward) and 5′-TTCTTGGGTTGGGTCGTTGTAC-3′ (reverse) for E-cadherin. Control PCR was performed using the following primers for GAPDH: 5′-CATCTTCTTTTGCGTCGCCA-3′ (forward) and 5′-TTAAAAGCAGCCCTGGTGACC-3′ (reverse). Quantitative PCR (Q-PCR) assays were performed in triplicate, and the mean values were used to calculate mRNA expression. Gene expression was normalized to GAPDH mRNA. The results were calculated and presented as 2^−ΔΔCT.