Total cellular RNA was isolated from cells using an RNeasy Mini Ki (Qiagen) and 1.0 μg was then reverse transcribed to cDNA using the High Capacity RNA to c-DNA kit (Life Technologies). Quantitative PCR reactions were performed using SYBR green PCR Master Mix (Applied Biosystems) on an ABI Prism 7300 platform (Life Technologies). The relative expression was normalized with the expression of the housekeeping gene 36B4. The sequences of primers used have been listed in Supplementary Table S1 .
Rneasy mini ki
Manufactured by Qiagen
The RNeasy Mini Kit is a laboratory tool designed for the isolation and purification of RNA from a variety of sample types. It utilizes a silica-membrane-based technology to efficiently capture and purify RNA molecules, making it a versatile solution for RNA extraction and analysis.
Automatically generated - may contain errors
Lab products found in correlation
Abi prism 7300 platform, by Thermo Fisher Scientific (1 mentions)
High capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions)
T100 thermal cycler, by Bio-Rad (1 mentions)
Taqman reverse transcriptase kit, by Roche (1 mentions)
2 protocols using rneasy mini ki
1
Quantitative PCR Analysis of Gene Expression
2
Sequencing NPM-ALK Kinase Domain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA extraction (RNeasy® Mini Ki; QIAgen) followed by cDNA synthesis (Taqman® Reverse Transcriptase kit; Roche) was carried out two independent times for all resistant cell lines as well as their respective parental lines. The NPM-ALK fusion was PCR amplified (Primers - Forward: GTCCGCCTTCTCTCCTACCT, Reverse: TTGGCACAAAACAAAACGTG) on a BioRad T100 Thermal Cycler. The kinase domain was sequenced by Sanger sequencing. The sequences obtained for the resistant lines were aligned to their respective parental lines using the ClustalW online sequence alignment tool to identify base pair changes. The identified mutations were the same for both independent sets of sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!