Total RNA was extracted from WT hT and AT 648 hT fibroblast cell lines treated with dex or not treated using the RNeasy mini kit (QIAGEN, 74104 Valencia, CA, USA). Five hundred nanograms of RNA were employed in each experiment to obtain cDNA PrimeScript™ RT Master Mix (Takara, Bio, Shiga, Japan). One nanogram of cDNA was used in each PCR reaction for TaqMan Gene Expression Assays (Thermo Fisher Scientific) of PPIC and PPIA as housekeeping genes. The target gene p21 expresion was evaluated by using the SYBR Green Premix Ex Taq Tli RNase H Plus (Takara) in combination with the primers 5′‐TGGAGACTCTCAGGGTCGAAAA‐3′ and 5′‐TTCCTGTGGGCGGATTAGG‐3′. The efficiency of the reaction was determined by standard curves (on average 97% efficiency), and the final standard dilution was sample CT inclusive. Amplification plots were analyzed using the ABI PRISM 7500 sequence detection system (Applied Biosystems, Waltham, MA, USA), and the relative DNA amounts were calculated by the 1/2ΔCt method.
Sybr green premix ex taq tli rnase h plus
Manufactured by Takara Bio
Sourced in Japan
SYBR Green Premix Ex Taq Tli RNase H Plus is a ready-to-use solution for real-time PCR. It contains SYBR Green I dye, Taq DNA polymerase, and RNase H Plus for the amplification and detection of DNA targets.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (1 mentions)
Abi prism 7500, by Thermo Fisher Scientific (1 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Quantinova sybr green pcr kit, by Qiagen (1 mentions)
Cfx96 real time pcr, by Bio-Rad (1 mentions)
Allprep dna rna protein mini kit, by Qiagen (1 mentions)
Superscript first strand synthesis system for rt pcr, by Thermo Fisher Scientific (1 mentions)
Abi prism 7500 sequence detection system, by Thermo Fisher Scientific (1 mentions)
Mda assay kit, by Nanjing Jiancheng (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Revertra ace, by Toyobo (1 mentions)
Lightcycler 480 2, by Roche (1 mentions)
5 protocols using sybr green premix ex taq tli rnase h plus
1
Quantifying p21 Expression in Fibroblasts
2
Quantitative PCR Amplification Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Based on the copies of PCR amplicons, serial dilutions were made to obtain concentrations from 1 x 10 6 to 1 x 10 1 . These serially diluted samples were subjected to the amplification condition by initial denaturation in 95°C for 5 min, 40 cycles of amplification at 95°C for 5 s, and 60°C for 10 s in the presence of QuantiNova SYBR Green PCR Kit (Cat#208052, Qiagen) or SYBR Green Premix ExTaq Tli RNase H Plus (cat#RR820L, Takara, Japan) in Qiagen 5-plex rotor gene real time PCR system.
3
Quantitative Real-Time PCR for Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted using AllPrep DNA/RNA/Protein mini kit (Qiagen, UK). Reverse transcription was carried out using kits from Invitrogen following the manufacturer’s instructions (SuperScript First-Strand Synthesis System for RT-PCR). Total RNA (0.2–5 μg) was used for reverse transcription. Reverse-transcribed cDNAs were subjected to real-time PCR, which was performed for genes of interest by using the SYBR Green Premix ExTaq (Tli RNaseH Plus) (Takara bio Inc., Japan) and the CFX96 Real-time PCR (Biorad, UK), according to manufacturer’s instructions. TaqMan probe for mouse 18 S rRNA, β-actin and Il-1β from Integrated DNA Technologies and custom-designed primers were used to detect Cdkn1b (F; AGCAGTGTCCAGGGATGAGGAA, R; TTCTTGGGCGTCTGCTCCACAG), Mmp2 (F; CAAGGATGGACTCCTGGCACAT, R; TACTCGCCATCAGCGTTCCCAT), Mmp9 (F; GCTGACTACGATAAGGACGGCA, R; TAGTGGTGCAGGCAGAGTAGGA), Nos2 (F; GAGACAGGGAAGTCTGAAGCAC, R; CCAGCAGTAGTTGCTCCTCTTC), Synaptophysin (F; CCTGTCCGATGTGAAGATGG, R; AGGTTCAGGAAGCCAAACAC) gene expression. Relative gene expression levels were obtained by normalization to the expression levels of 18 S ribosomal RNA (Cdkn1b and Synaptophysin) or β-actin (Mmp9, Mmp2, Nos2, Il-1β).
4
Characterization of THBS1 and BRCA1 Promoter Interactions
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For THBS and BRCA1 promoter- pRB, LAP2α, E2F1 and Lamin A/C binding studies, the chromatin was prepared as previously described and immunoprecipitated with the specific antibodies. MOCK samples were prepared as controls. The obtained purified DNAs, recovered as previously described, were amplified by qPCR using the SYBR Green Premix Ex Taq Tli RNaseH Plus (Takara). The employed primers surrounding the E2F1 binding site in the BRCA1 promoter80 (link) were: forward 5′-CACAGGTCTCCAATCTATCCA-3′ and reverse 5′-GTCAGAATCGCTACCTATTGTC-3′, while for THBS181 (link) they were: forward 5′-TTTCTAGCTGGAAAGTTGCG-3′ and reverse 5′-GTAGAGGTTGCTCCTGGAGAG-3′. The qPCRs efficiency was established by standard curves (on average 95% efficiency), ensuring that last standard dilution was sample CT inclusive. Amplification plots were analyzed using the ABI PRISM 7500 sequence detection system (Applied Biosystems) and the relative DNA amounts were calculated by the ½ Ct method.
5
Measuring Cochlear Oxidative Stress Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Malondialdehyde (MDA) is a lipid peroxidation product. MDA levels in cochleae were measured using an MDA assay kit (Nanjing Jiancheng Bioengineering Institute, Catalog No. A003-1), and the experimental methods were carried out according to the manufacturer's instructions.
2.9. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) Dissections of cochleae were followed by immersion in cold PBS and then collection of whole cochlear tissue with bone removed for qRT-PCR. Total RNA was isolated using TRIzol (Invitrogen, Carlsbad, USA), and 1 µg of the extracted total RNA was reverse-transcribed to cDNA following the protocol of ReverTra Ace (Toyobo, Osaka, Japan). Ampli cation of cDNA samples was performed on a LightCycler 480 II (Roche, Rotkreuz, Switzerland) using SYBR Green Premix Ex Taq™ (Tli RNase H Plus; TaKaRa, Dalian, China). Cycling parameters were 3 min at 95°C, followed by 40 cycles for 15 s at 95°C, 1 min at 60°C, and 30 s at 72°C. Each sample was ampli ed three times followed by calculation of the mean value. Relative mRNA levels of NQO1 and HO-1 were normalized to GAPDH using the 2(- Delta Delta CT) method. The primers used in the present study are displayed in Table 1.
Table 1 The primers used in the present study.
2.9. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) Dissections of cochleae were followed by immersion in cold PBS and then collection of whole cochlear tissue with bone removed for qRT-PCR. Total RNA was isolated using TRIzol (Invitrogen, Carlsbad, USA), and 1 µg of the extracted total RNA was reverse-transcribed to cDNA following the protocol of ReverTra Ace (Toyobo, Osaka, Japan). Ampli cation of cDNA samples was performed on a LightCycler 480 II (Roche, Rotkreuz, Switzerland) using SYBR Green Premix Ex Taq™ (Tli RNase H Plus; TaKaRa, Dalian, China). Cycling parameters were 3 min at 95°C, followed by 40 cycles for 15 s at 95°C, 1 min at 60°C, and 30 s at 72°C. Each sample was ampli ed three times followed by calculation of the mean value. Relative mRNA levels of NQO1 and HO-1 were normalized to GAPDH using the 2(- Delta Delta CT) method. The primers used in the present study are displayed in Table 1.
Table 1 The primers used in the present study.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!