Calcium chloride anhydrate, poly-acrylic acid (PAA), (3-Aminopropyl) trieyhoxysilane (APTES), tetraethylorthosilicate (TEOS), glutaraldehyde solution (GA), ethanolamine, oxytetracycline (OTC), tris(hydroxymethyl)aminomethane, Hexane, FeCl2, and FeCl3 were purchased from Sigma-Aldrich and used without any additional purification. oxytetracycline binding aptamer(OBA) was synthesized from GenoTech Corp. (Daejeon, Korea). The sequence was 5’-CGTACGGAATTCGCTAGCACGTTGACGCTGGTGCCCGGTTG TGGTGCGAGTGTTGTGTGGATCCGAGCTCCACGTG -3′. The dissociation constant (Kd) of the OBA was 12.08 ± 2.25 nM [35 (link)]. For confocal microscopy, Fluorescence tag (FAM) was modified at 3′ end of the aptamer.
Calcium chloride anhydrate
Manufactured by Merck Group
Calcium chloride anhydrate is a white, crystalline powder. It is a chemical compound with the formula CaCl2. Calcium chloride anhydrate is used as a desiccant and in various industrial applications.
Automatically generated - may contain errors
Lab products found in correlation
Sodium chloride (nacl), by Avantor (2 mentions)
Taurocholic acid sodium salt hydrate, by Merck Group (2 mentions)
Pancreatin from porcine pancreas, by Merck Group (2 mentions)
Chloroform, by Avantor (2 mentions)
Glyceryl tripalmitate, by Merck Group (2 mentions)
Acetonitrile, by Avantor (2 mentions)
Maleic acid, by Merck Group (2 mentions)
Pepsin from porcine gastric mucosa, by Merck Group (2 mentions)
Glyceryl dipalmitate, by Larodan (2 mentions)
Phospholipids soy phosphatidylcholine spc, by Lipoid (2 mentions)
Tris buffer, by ICN Biomedicals (2 mentions)
Nan comfort stage 1, by Nestlé (2 mentions)
Palmitic acid, by Merck Group (2 mentions)
Acetic acid, by Merck Group (2 mentions)
Oxytetracycline, by Merck Group (1 mentions)
Fecl2, by Merck Group (1 mentions)
Glutaraldehyde solution, by Merck Group (1 mentions)
Fecl3, by Merck Group (1 mentions)
Hexane, by Merck Group (1 mentions)
Ethanolamine, by Merck Group (1 mentions)
3 protocols using calcium chloride anhydrate
1
Oxytetracycline Aptamer-Based Biosensor
2
Lipid Digestion and Absorption Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Maleic acid, taurocholic acid sodium salt hydrate, calcium chloride anhydrate (CaCl2), acetic acid (AcOH) (≥99.8%), pepsin from porcine gastric mucosa, pancreatin from porcine pancreas, glyceryl tripalmitate (99%), and palmitic acid (99%) was purchased from Sigma Aldrich (St. Louis, MO, USA). Glyceryl dipalmitate (>99%) was purchased from Larodan (Solna, Sweden). Phospholipids (soy phosphatidylcholine (SPC)) was purchased from Lipoid (Köln, Germany). Chloroform (CHCl3), methanol (MeOH), dichloromethane (DCM), and acetonitrile (ACN), all HPLC grade, as well as sodium chloride (NaCl) was purchased from VWR chemicals (Darmstadt, Germany). Tris buffer was purchased from ICN Biomedicals (Santa Ana, CA, USA). Pure Akonino NS oil was purchased from AAK (Karlshamn, Sweden), while Arasco oil and MEG-3 oil were purchased from DSM (Mulgrave, Canada). Concentrate of rHGL (in solution) produced in HEK cells was generously provided by Bioneer A/S (Hoersholm, Denmark). NAN Comfort stage 1 (Nestlé, Rhodes, NSW, Australia) (NAN1) was purchased at Coles Supermarket in Australia. All water used for this study was of ultra pure (UP) quality ( 18MΩ) from an SG Ultra Clear 2002 system (Evoqua, Pittsburgh, PA, USA) or equivalent.
3
Lipid Digestion and Absorption Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Maleic acid, taurocholic acid sodium salt hydrate, calcium chloride anhydrate (CaCl2), acetic acid (AcOH) (≥99.8%), pepsin from porcine gastric mucosa, pancreatin from porcine pancreas, glyceryl tripalmitate (99%), and palmitic acid (99%) was purchased from Sigma Aldrich (St. Louis, MO, USA). Glyceryl dipalmitate (>99%) was purchased from Larodan (Solna, Sweden). Phospholipids (soy phosphatidylcholine (SPC)) was purchased from Lipoid (Köln, Germany). Chloroform (CHCl3), methanol (MeOH), dichloromethane (DCM), and acetonitrile (ACN), all HPLC grade, as well as sodium chloride (NaCl) was purchased from VWR chemicals (Darmstadt, Germany). Tris buffer was purchased from ICN Biomedicals (Santa Ana, CA, USA). Pure Akonino NS oil was purchased from AAK (Karlshamn, Sweden), while Arasco oil and MEG-3 oil were purchased from DSM (Mulgrave, Canada). Concentrate of rHGL (in solution) produced in HEK cells was generously provided by Bioneer A/S (Hoersholm, Denmark). NAN Comfort stage 1 (Nestlé, Rhodes, NSW, Australia) (NAN1) was purchased at Coles Supermarket in Australia. All water used for this study was of ultra pure (UP) quality ( 18MΩ) from an SG Ultra Clear 2002 system (Evoqua, Pittsburgh, PA, USA) or equivalent.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!