Log In Sign up
The largest database of trusted experimental protocols

Nlrp3

Manufactured by Qiagen
Visit Supplier
Sourced in Germany

Nlrp3 is a lab equipment product manufactured by Qiagen. It is a component of the inflammasome complex, which plays a role in the immune response. The core function of Nlrp3 is to detect and respond to various stimuli, triggering the activation of the inflammasome.

Automatically generated - may contain errors

Lab products found in correlation

Gotaq qpcr master mix, by Promega (1 mentions) Ifnβ1, by Qiagen (1 mentions) Mb21d1, by Qiagen (1 mentions) Cxcl10, by Qiagen (1 mentions) Ifna2, by Qiagen (1 mentions) Goscript reverse transcription kit, by Promega (1 mentions) Ifna4, by Qiagen (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Nanodrop spectrophotometer, by Thermo Fisher Scientific (1 mentions) Interleukin 6 (il 6), by Qiagen (1 mentions) Il 1α, by Qiagen (1 mentions) Ifn γ, by Qiagen (1 mentions) Tgfβ1, by Qiagen (1 mentions) Il 1β, by Qiagen (1 mentions) Tnf α, by Qiagen (1 mentions) Interleukin 4 (il 4), by Qiagen (1 mentions) Il 10, by Qiagen (1 mentions) Il 1r1, by Qiagen (1 mentions) Casp1, by Qiagen (1 mentions) Ywhaz, by Thermo Fisher Scientific (1 mentions)

4 protocols using nlrp3

1

mRNA Expression Analysis of Innate Immune Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total mRNA was extracted using TRIzol (TRI-Reagent, Sigma-Aldrich, Germany) and reverse transcribed in cDNA with GoScript™ Reverse Transcription kit (Promega, Wisconsin). Genes mRNA expression were analyzed using GoTaq®qPCR Master Mix (Promega). All primer sequences used were from Qiagen: Tmem173 (#QT00261590), Mb21d1 (#QT00131929), Nlrp3 (#QT00122458), Ifi204 (#QT01753535), Ddx41 (#QT00137130), Aim2 (#QT00266819), Cxcl10 (#QT00093436), Ifna2 (#QT00253092), Ifna4 (#QT01774353), and Ifnβ1 (#QT00249662). RNA expression was normalized to Rn18s expression (Qiagen, Maryland). Data were analyzed using the comparative analysis of relative expression by ΔΔCt methods.
Messaoud-Nacer Y., Culerier E., Rose S., Maillet I., Rouxel N., Briault S., Ryffel B., Quesniaux V.F, & Togbe D. (2022). STING agonist diABZI induces PANoptosis and DNA mediated acute respiratory distress syndrome (ARDS). Cell Death & Disease, 13(3), 269.
+ Open protocol
+ Expand
2

Placental Cytokine mRNA Expression

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from placental villous tissue using the RNeasy mini kit (Qiagen). RNA purity and concentration was determined using a Nanodrop Spectrophotometer (Thermo Scientific). RNA (250 ng) was reverse transcribed as previously described.15 (link) Primers for the following were used: IL-1β, IL-1α, IL-6, TNFα, IL-18, IL-12β, IFNγ, IL-1Ra, IL-10, IL-4, TGFβ1, IL-1R1, IL-1R2, Casp1, and NLRP3 (Qiagen, UK). Real time PCR system (7900 HT; Applied Biosystem, Warrington, UK) was used, mRNA expression quantified using SYBR green I with a dissociation curve analysis performed to ensure amplification specificity. Expression in villous tissue samples was normalized to the housekeeping gene YWHAZ (forward= CCTGCATGAAGTCTGTAACTGAG, reverse= TTGAGACGACCCTCCA-AGATG, Invitrogen, UK), and the data are presented as relative expression.
Girard S., Heazell A.E., Derricott H., Allan S.M., Sibley C.P., Abrahams V.M, & Jones R.L. (2014). Circulating Cytokines and Alarmins Associated with Placental Inflammation in High-Risk Pregnancies. American Journal of Reproductive Immunology, 72(4), 422-434.
+ Open protocol
+ Expand
3

Colonic Gene Expression Analysis in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mice colons were dissected at 5th and 15th day of the experimental period. After wash with PBS to remove the presence of feces, colons were immediately frozen in liquid nitrogen. Total RNA was extracted using TRIzol Reagent (Bio-Rad Laboratories) and following a specific RNA extraction kit (NucleoSpin®, MACHEREY-NAGEL GmbH & Co, Düren, Germany), according to the manufacturer’s instructions. cDna was synthesized using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) from 4 µg total RNA. The applied PCR settings were previously described45 (link). The used gene primers were: Il1b (for IL-1β), Il6 (for IL-6), Tnfa (for TNF-α), Prostaglandin-endoperoxide synthase (Ptgs) 2 (for COX-2), Ifng (for IFN-γ), AnxA1 (for Annexin A1), Il10 (for IL-10), Tff3 (for TFF3), Muc2 (for mucin 2), Ocln (for Occludin), Tlr2 (for TLR2), MyD88 (for MYD88), Hdac9 (for HDAC9), Slc16a1 (for MCT1) and Nlrp3 (for NALP3) (Qiagen, Hilden, Germany) in a final volume of 25 μl. All studied mRNAs were normalized to Gapdh (for GAPDH) or Actb (for β-actin) as housekeeping gene, and data were analyzed according to the 2−ΔΔCT method.
Lama A., Annunziata C., Coretti L., Pirozzi C., Di Guida F., Nitrato Izzo A., Cristiano C., Mollica M.P., Chiariotti L., Pelagalli A., Lembo F., Meli R, & Mattace Raso G. (2019). N-(1-carbamoyl-2-phenylethyl) butyramide reduces antibiotic-induced intestinal injury, innate immune activation and modulates microbiota composition. Scientific Reports, 9, 4832.
+ Open protocol
+ Expand
4

Quantitative Analysis of Inflammasome Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
All primers (NLRP3, ASC, caspase-1, caspase-5, caspase-8, IL-1β, and IL-18) (Qiagen GmbH, Hilden, Germany) were cDNA-specific. Samples were evaluated for glyceraldehyde 3-phosphate-dehydrogenase (GAPDH) expression by real-time PCR to test the quality of RNA. Results were expressed as ΔΔCt (where Ct is the cycle threshold) and are presented as ratios between the target gene and the GAPDH housekeeping mRNA. A Bio-Rad CFX Real-Time PCR instrument (Bio-Rad, Hercules, California, USA) with RT2 SYBR Green qPCR mastermix (Qiagen) was used to perform quantitative PCR (qPCR). Results are expressed as the fold changes between stimulated/unstimulated condition. Heat maps were generated and genes hierarchically clustered by Euclidean distance and single linkage using TIGR MultiExperiment Viewer (MeV) v4.9.
La Rosa F., Varotto-Boccazzi I., Saresella M., Marventano I., Cattaneo G.M., Hernis A., Piancone F., Otranto D., Epis S., Bandi C, & Clerici M. (2024). The non-pathogenic protozoon Leishmania tarentolae interferes with the activation of NLRP3 inflammasome in human cells: new perspectives in the control of inflammation. Frontiers in Immunology, 15, 1298275.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!