Sybr premix ex taq 2 2 kit

Total RNA was extracted from mouse tissues and cells with TRIzol reagent (TaKaRa, Dalian, China). Then, RT-qPCR was performed in a CFX96 real-time quantitative PCR detection system (Bio-Rad, Hercules, CA, USA) according to the instructions of SYBR Premix Ex Taq II (2×) kit (TaKaRa, Dalian, China). The relative expression levels of mRNAs and miRNAs were calculated using the 2^−∆∆Ct method. ACTB was selected as the internal reference for mRNA, and U6 was selected as the internal reference for miRNA. The primer sequences used in this study are shown in Table S1.

Total cellular RNA was extracted using RNAiso plus reagent (9,108, Takara, Kyoto, Japan) according to the manufacturer’s instructions. Subsequently, the total RNA concentration was determined with a NanoDrop 2.0 spectrophotometer (Thermo Fisher Scientific, Pittsburgh, PA, United States) and the RNA was reverse transcribed to cDNA using a PrimeScript™ RT reagent kit with gDNA Eraser (RR047A, Takara) according to the manufacturer’s instructions. Subsequently, qRT-PCR assays were performed by using a SYBR Premix Ex Taq™ II (2×) kit (RR820A, Takara) according to the manufacturer’s instructions and run on an ABI 7500 Real-Time PCR Detection System (Foster City, CA, United States). The reactions were performed using the following parameters: 95°C for 30 s followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. The primer nucleotide sequences used for qRT-PCR are listed in Supplementary Table S1. All primer sets for mRNA amplification were purchased from Sangon Biotech (Shanghai) Co., Ltd. (Shanghai, China). The relative expression levels of the target gene were normalized with respect to the levels of β-actin expression and calculated using the 2^−△△CT method.

Two cold-sensitive genes Cla020078 (CBF1) and Cla020702 (MYB) were chose to perform quantitative real-time PCR (qRT-PCR). Total RNA was extracted using a RNA extraction kit (Tiangen, Beijing, China) according to the supplier’s instructions. DNA contamination was removed using a purifying column. One microgram of total RNA was reverse-transcribed using the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) following the supplier’s instructions. The gene-specific primers for qRT-PCR were designed based on their cDNA sequences, as follows: Cla020078 (F, AGCAGAGCCCTAACACAGGT; R, AATGGTCTTGAGTTGGG), Cla020702 (F, GATCCATTGACGGCACTAAC; R, TCGCTACAACGTCCTTCATC), and watermelon β-actin gene (F, CCATGTATGTTGCCATCCAG; R, GGATAGCATGGGGTAGAGCA) was used as an internal control (Kong et al., 2014 (link)). The qRT-PCR assays were performed using an iCycler Iq Multicolor PCR Detection System (Bio-Rad, Hercules, CA, USA). PCRs were performed using the SYBR Premix ExTaq II (2×) Kit (Takara, Tokyo, Japan). The PCR conditions consisted of denaturation at 95°C for 3 min, followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s. The quantification of mRNA levels was based on the method of Livak and Schmittgen (2001) (link).

Total RNA was extracted using the RNA extraction kit from Axgen (Union City, CA, United States) according to the manufacturer’s instructions. After extraction, the RNA samples were treated with gDNase to remove DNA, then reverse-transcribed (1 μg per sample) to cDNA using a ReverTra Ace qPCR RT kit (Toyobo, Osaka, Japan). Quantitative Real-Time PCR was conducted using SYBR Premix ExTaqII (2×) Kit (Takara, Tokyo, Japan) on an iCycler Iq TM Multicolor PCR Detection System (Bio-Rad, Hercules, CA, United States; Li et al., 2017 (link)). β-ACTIN was used as an internal control gene. Primers used for gene expression analyses are listed in Supplementary Table S1. The relative expression of genes was calculated using the 2^−ΔΔCT method as reported in Livak and Schmittgen (2001) (link).