The largest database of trusted experimental protocols

One shot stbl3 chemically competent e coli cells

Manufactured by Thermo Fisher Scientific

One Shot® Stbl3™ chemically competent E. coli cells are a laboratory strain of Escherichia coli bacteria that have been genetically modified to be highly efficient at taking up and incorporating foreign DNA during transformation. They are designed for the cloning and propagation of plasmid DNA.

Automatically generated - may contain errors

2 protocols using one shot stbl3 chemically competent e coli cells

1

Lentiviral shRNA Construct Production

Check if the same lab product or an alternative is used in the 5 most similar protocols
A vial of One Shot® Stbl3™ chemically competent E. coli cells (Thermo Fisher Scientific) was used for each transformation. A shRNA construct containing the target sequence for the SP7 gene (AGGTGTATGGCAAGGCTTCGC ACCTGAAG) and a Scrambled Control were cloned in separate lentiviral GFP vectors with expression under the U6 promoter (pGFP-C-shLenti, Origene). Bacterial cells and plasmids were combined, incubated on ice, heat shocked at 42°C, and re-incubated on ice before inoculation in Luria Broth (LB) in a shaking incubator at 37°C. After the outgrowth step, transformants were screened by spread-plating 200 uL of suspension on Luria Agar plates with chloramphenicol (Sigma-Aldrich) (LA-C) and incubated at 37°C overnight. A single colony was streaked on LA-C plates and a purified colony was inoculated in 200 mL LB with chloramphenicol for overnight expansion in a shaking incubator at 37°C. Plasmids were isolated and purified using NucleoBond Xtra Midi Kit (Takara Bio) following the manufacturer’s protocol. Plasmid DNA concentration and purity were measured using a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific).
+ Open protocol
+ Expand
2

Lentiviral Expression of SAE2 and UBC9

Check if the same lab product or an alternative is used in the 5 most similar protocols
cDNA synthesis was performed from total RNA extracted from t-hESC and primed with oligo(dT), using SuperScript III First Strand Synthesis System (Thermo Fisher Scientific). Wild type SAE2 and UBC9 ORF were amplified by RT-PCR using Phusion Hot Start II DNA polymerase (Thermo Fisher Scientific) and subcloned into pUC19 vector using InFusion HD Cloning Kit (Takara Bio USA). Both, SAE2 and UBC9 ORFs were then PCR amplified and subcloned into pLV-mCherry plasmid (Addgene #36084). All PCR steps described above have been performed using Phusion Hot Start II DNA polymerase (Thermo Fisher Scientific). All subcloning steps have been performed in OneShot Stbl3 Chemically Competent E. coli cells (Thermo Fisher Scientific). Lentiviral expression plasmids were co-transfected with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) as previously described(Benoit et al., 2017 (link)). Medium was collected, centrifuged to remove cells and debris, filtered through a 0.45um filter and then ultracentrifuged at 20K x g for 2hr at 4°. Concentrated lentivirus was re-suspended in 0.5ml of PBS per 75cm2 flask of 293-FT cells worth of supernatant. Individual lentivirus preps were titrated on the desired cell line to be transduced in order to optimize expression but minimize transduction induced cell death.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!