Dna isolation kit

Genomic DNA isolated from the OSCC cell lines and patient samples was purified using a DNA isolation kit (Zymo Research, Irvine, CA, USA) and treated with sodium bisulfite using an EZ DNA methylation kit (Zymo Research, Irvine, CA, USA). Subsequently, a polymerase chain reaction (PCR) was performed to amplify the PTK6 promoter region, using Taq DNA polymerase (Invitrogen, Waltham, MA, USA). The pyrosequencing of the PCR products was performed using a PyroMark Gold Q24 Reagent kit (Qiagen, Hilden, Germany) to analyze the methylation status of the PTK6 promoter. Primers and PCR conditions designed using PyroMark Assay Design 2.0 software were used to amplify specific CpG islands. Methylated CpG sites were detected using a PyroMark Q24 system. The PTK6 S1 sequence for detection was CCGGACGGACGAGGAGCTGAGCTTCCGCGCGGGGGACGTCTTCCACGTGGCC (+125~+171) and the pyrosequence-designed nucleotide sequence for analysis was TYGGAYGGAYGAGGAGTTGAGTTTTYGYGYGGGGGAYGTTTTTTAYGTGG. The PTK6 S2 sequence for detection was TACCTGGCCGAGAGGGAGACGGTGGAGTCGGAACCGTGCG (+266~+298) and the pyrosequence-designed nucleotide sequence for analysis was TATTTGGTYGAGAGGGAGAYGGTGGAGTYGGAATYGTGYGTGTTTTAGGT. The primer sequences used in PCR and pyrosequencing are shown in Supplementary Table S1.

DNA was extracted from GC-2 cells using a DNA Isolation Kit and was chemically modified using an EZ DNA Methylation-Gold Kit (Zymo Research, Orange, CA, USA). Primer pairs that specifically amplified either methylated or unmethylated sequences spanning the CpG islands of selected genes were used for MSP, as detailed in S1 Table. MSP was carried out as in our previous studies[24 (link)].