Blood was collected from six wild-caught RCMs in Nigeria according to the Guide for the Care and Use of Laboratory Animals47 under a NIAID Animal Care and Use Committee-approved protocol28 (link)29 (link). RCM genomic DNA was isolated from cryopreserved peripheral blood mononuclear cells28 (link)29 (link), and PCR was performed by using PfuUltra High Fidelity DNA polymerase (Agilent Technologies) and the following primers: 5′-CAG CTA GAG GGG AGA TCT GGA TG-3′; 5′-CTC ACT GAC CAG CTT CCT GGG-3′, which were used in a previous study31 (link). The obtained PCR products (approximately 2 kb) were purified by gel extraction and directly sequenced by using BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems) with the two primers described above and the following 4 primers: 5′-GGA CTT CAC CAG ACC CTG AA-3′; 5′-TTC AGG GTC TGG TGA AGT CC-3′; 5′-TCT CTC CTT TGC TCC CAA AA-3′; 5′-TTT TGG GAG CAA AGG AGA GA-3′. The sequencing PCR was performed by using ABI Prism 3130 xl genetic analyzer (Applied Biosystems), and the data was analyzed by Sequencher v5.1 software (Gene Codes Corporation).
Pfuultra high fidelity dna polymerase
Manufactured by Agilent Technologies
Sourced in United States, Germany
PfuUltra High-Fidelity DNA polymerase is a thermostable DNA polymerase enzyme used for high-fidelity DNA amplification. It exhibits proofreading activity, which results in a lower error rate compared to other DNA polymerases.
Automatically generated - may contain errors
Lab products found in correlation
T4 dna ligase, by New England Biolabs (7 mentions)
Antarctic phosphatase, by New England Biolabs (6 mentions)
Probond nickel chelating resin, by Thermo Fisher Scientific (5 mentions)
Kanamycin monosulfate, by GoldBio (5 mentions)
Xhoi, by New England Biolabs (5 mentions)
Isopropyl β d 1 thiogalactopyranoside (iptg), by GoldBio (4 mentions)
Restriction enzyme, by New England Biolabs (3 mentions)
Escherichia coli strain neb5α, by New England Biolabs (3 mentions)
Acetyl coa, by Merck Group (3 mentions)
Oligonucleotides, by Eurofins (3 mentions)
Sequencher v5, by Gene Codes (2 mentions)
Pcdna3.1 vector, by Thermo Fisher Scientific (2 mentions)
Hc toxin, by Cayman Chemical (2 mentions)
Qiaquick pcr purification kit, by Qiagen (2 mentions)
Xl1 blue chemically competent cells, by Agilent Technologies (2 mentions)
Dpni, by New England Biolabs (2 mentions)
Butyryl coa, by Merck Group (2 mentions)
Hexanoyl coa, by Merck Group (2 mentions)
Oleoyl coa, by Merck Group (2 mentions)
Quikchange site directed mutagenesis kit, by Agilent Technologies (2 mentions)
51 protocols using pfuultra high fidelity dna polymerase
1
RCM Genomic DNA Isolation and Sequencing
2
HIVEP2 cDNA Cloning and Luciferase Reporter Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human HIVEP2 cDNA ORF (7.3 kb) was cloned by PfuUltra High-fidelity DNA Polymerase (Agilent Technologies) chain reaction (PCR) and then ligating the PCR product into the indicated sites in the mammalian expression vector pcDNA3.1+, resulting in the plasmid pcDNA3.1 + HIVEP2. The cloning PCR used primers for NheI (NEB)/NotI (NEB) sites-directed insertion. The PCR templates were cDNAs synthesized from total RNAs isolated from a combination of human SK-N-AS, IMR-32, and SH-SH5Y cells23 (link). PCR fidelity was verified by DNA re-sequencing.
For luciferase (Luc) assay13 (link), three reporter plasmids were generated: 1, 2A and 2B. For constructing each plasmid, two complementary single-stranded synthetic oligonucleotides were annealed together into a double-stranded oligonucleotide with NheI at the 5′ end and XhoI (NEB) at the 3′ end, followed by ligation of the double-stranded oligonucleotide to the same restriction sites immediately upstream of the SV40 promoter in Promega’s pGL3 Promoter Vector.
For luciferase (Luc) assay13 (link), three reporter plasmids were generated: 1, 2A and 2B. For constructing each plasmid, two complementary single-stranded synthetic oligonucleotides were annealed together into a double-stranded oligonucleotide with NheI at the 5′ end and XhoI (NEB) at the 3′ end, followed by ligation of the double-stranded oligonucleotide to the same restriction sites immediately upstream of the SV40 promoter in Promega’s pGL3 Promoter Vector.
3
Generating LTAaj Mutants by Site-Directed Mutagenesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The wild-type LTAaj (for sequence and alignment with PDB:3WGB template see Supplementary Information ) was cloned in pEamTA vector with a C-terminal His-tag as previously described (Fesko et al., 2015 (link)). LTAaj mutants were generated by site-directed mutagenesis according to Agilent's QuikChange II protocol using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies). The pEamTA-LTAaj plasmid was used as the template. Primers were ordered at Integrated DNA Technologies. PCR was carried out under the following conditions: 50 μL total volume, 200 μM of each dNTP, 0.2 μM of each primer, 5 ng of template plasmid DNA, and 2.5 U of PfuUltra High-Fidelity DNA Polymerase. Cycling conditions were as follows: initial denaturation at 95°C for 2 min, followed by 21 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 60 s, extension at 68°C for 8 min. Amplification was controlled by electrophoresis of 10 μL of the PCR reaction on an agarose gel. After the digestion of parental non-mutated methylated plasmid DNA with DpnI at 37°C for 1 h, the samples were desalted and electro-competent Escherichia coli BL21(DE3) cells were transformed with the resulting nicked vector DNA containing the desired mutations. The introduction of mutations was confirmed by sequencing analysis (LGC genomics).
4
Cloning and Mutagenesis of SOXE Transcription Factors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human SOXE and SOX17 expression plasmids were generated by cloning full-length coding sequences in frame with an N-terminal 3FLAG epitope (35 (link)) in the pcDNA3.1(+) vector (Thermo Fisher Scientific, Waltham, MA, USA). These sequences were amplified by PCR using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies, Santa Clara, CA, USA) and human cDNA using forward and reverse primers containing BamHI and EcoRI sites, respectively (Supplementary Table S2 ). Plasmids encoding GAL4DBD/SOXE fusion proteins were generated by cloning SOXE cDNA segments into the pBIND plasmid (Promega, Madison, WI, USA). These segments were generated by PCR using custom-made primers (Supplementary Table S3 ). Missense mutations were introduced in SOX sequences by QuikChange Site-Directed Mutagenesis (Stratagene, San Diego, CA, USA) using tailored primers (Supplementary Table S4 ). The integrity of all plasmid inserts was verified by Sanger sequencing.
5
Recombinant protein expression in E. coli
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Recombinant proteins were expressed in E. coli BL21 (DE3) pLysS strains from a vector derived from pET23b (Novagen). BPTI constructs were expressed with a leading methionine, used as a start codon, but the wild-type was otherwise identical to mature BPTI. The wild-type BPTI construct, and details of expression, isolation and solubilisation of inclusion bodies were described previously [25] (link). To generate Cys-to-Ser mutations, PCR was performed using PfuUltra High-Fidelity DNA Polymerase (Agilent) to amplify the entire vector, following manufacturers' guidelines. PDI constructs included a His-tag sequence (MHHHHHHM ) to facilitate purification and were expressed and purified as described previously [26] (link). To produce 15N-labeled proteins, cells were grown in minimal medium containing 1 g/l of 15N ammonium sulfate.
6
Directed Mutagenesis of pRH281-ME2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The plasmid pRH281-ME2 was amplified using mutagenic primers (Table S4 ) for 16–18 thermocycles with a pfuUltra high-fidelity DNA polymerase (Agilent, Santa Clara, CA, USA). After digestion with the DpnI restriction enzyme (TaKaRa, Shiga, Japan) to remove the wild-type template plasmid, the DNA products were transformed into Escherichia coli XL-10. Finally, autosequencing was used to identify ME2 single mutants.
7
Constructing pre-miRNA expression vectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pre-miRNA expression vectors were constructed by amplifying a ~0.5-kb DNA fragment encompassing the pre-miRNA region using the human genomic DNA (heterozygous for the variant of interest) as a template. Using PfuUltra high-fidelity DNA polymerase (Agilent, Santa Clara, CA, USA), PCR reactions were performed with the designed primers (Supplementary Table S2 ) by an Applied Biosystems 9700 Thermal cycler with annealing and elongation temperatures of 58°C and 72°C. The amplified fragments were purified with PCR purification kit (Qiagen) and analyzed on 1.5% agarose gels. The resulting fragments were cloned into a lentiviral vector (pCDH-CMV-EF1-Puro-GFP) using XbaI and BamHI or NheI and BamHI restriction enzymes (Supplementary Table S2 ). The plasmids that contained the wild-type or mutant miRNA genes were identified by Sanger sequencing.
8
Biochemical Assay for HDAC Inhibitors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PCR reactions were performed using the PfuUltra High-Fidelity DNA polymerase (Agilent Technologies). Restriction enzymes were purchased from New England Biolabs and used according to the manufacturer’s instructions. Custom oligonucleotides were synthesized by Integrated DNA Technologies. Escherichia coli strain NEB5α (New England Biolabs) was used for cloning procedures. Assay substrates 1–2 and 7–13 were purchased from GenScript®, and assay substrates 3–6 were purchased from Enzo® Life Sciences. HC toxin was purchased from Cayman Chemicals. A sample of 7-[(3-aminopropyl)amino]-1,1,1-trifluoroheptan-2-one was synthesized according to published procedures35 (link) and determined to be >95% pure by mass spectrometry, NMR spectroscopy, and X-ray crystallographic structure validation. All other HDAC inhibitors were purchased from ApexBio®. All substrates and inhibitors were purchased as >95% pure preparations and used without further purification.
9
APOE Promoter Region Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from the APOE promoter region (positions −1983 to +935) was amplified from one AD patient with ε4/ε4 and rs405509-TT genotypes and one control with ε3/ε3 and rs405509-GG genotypes) using the following primers: forward, 5′-GGGGTACC GAAAGCAGCGGATCCTTGAT -3′; reverse, 5′-CCCCTCGAGCTTCCTGCCTGTGATTGGC -3′. The amplified DNA from each subject was digested with KpnI and XhoI and ligated into the pGL3.basic vector (Promega, Madison, WI, USA). PCR based site-directed mutagenesis of rs405509 (−219G/T) was carried out to replace T by G for the construct from AD patient and G by T from control using the following primers: T → G forward, 5’-GAGGAGGGTGTCTGGATTACTGGGCGAG-3’; reverse, 5′- CTCGCCCAGTAATCCAGACACCCTCCTC -3′, G → T forward, 5’-GAGGAGGGTGTCTGTATTACTGGGCGAGG-3’; 5’-CCTCGCCCAGTAATACAGACACCCTCCTC-3’. The reactions were performed using PfuUltra High-Fidelity DNA Polymerase (Agilent Technologies Inc, Santa Clara, CA, USA).
10
Enhancer Cloning and Haplotype Generation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Selected promoters were obtained from the LightSwitch Promoter Collection (SwitchGear Genomics) and sequence verified in the pLightSwitch_Prom vector. Candidate enhancers were amplified from human genomic DNA (Roche) using oligonucleotides designed in Primer3 with 16 bp overhangs (5′-GCTCGCTAGCCTCGAG-3′ and 5′CGCCGAGGCCAGATCT-3′ ) complementary to the sequence flanking the BglII and XhoI sites in the pGL4.23 vector (Promega). Primers were designed to encompass the PXR/p300 ChIP-seq peak plus up to 500 bp of sequence on either side of the peak. PCR products were cleaned using the QIAquick PCR Purification Kit (Qiagen) and cloned into BglII and XhoI digested pGL4.23 using the Infusion HD cloning system (Clontech). Haplotypes were generated either by PCR amplification of DNA from various ethnic individuals or by site-directed mutagenesis using mutant primers amplified by PfuUltra High Fidelity DNA polymerase (Agilent) followed by DpnI digestion of the parental DNA (New England Biolabs) and transformation into competent cells. Sequences were verified by Sanger sequencing using RVPrimer3 (5′-CTAGCAAAATAGfGCTGTCCC-3′ ) and a custom reverse primer (5′-TCTTCCATGGTGGCTTTACC-3′ ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!