Primers were designed for genes of interest using PyroMark Assay Design software (Qiagen, United States) (Supplementary Table S1 ) . Bisulfite conversion of 40 ng of spermatic DNA was prepared by EZ DNA Methylation-Gold kit (Zymo Research, United States). Twenty ng of bisulfite converted DNA were amplified for pyrosequencing using Pyromark Q24 kit (Qiagen, United States) and Pyromark Q24 Vacuum workstation (Qiagen, United States) according to the manufacturer’s instructions.
Pyromark q24 kit
Manufactured by Qiagen
Sourced in United States, Germany
The PyroMark Q24 kit is a laboratory equipment designed for DNA sequence analysis. It utilizes the pyrosequencing method to provide accurate and reliable DNA sequence data.
Automatically generated - may contain errors
Lab products found in correlation
Pyromark q24 vacuum workstation, by Qiagen (1 mentions)
Pyromark assay design software, by Qiagen (1 mentions)
Ez dna methylation gold kit, by Zymo Research (1 mentions)
Pyromark q24, by Qiagen (1 mentions)
Epitaq hs, by Takara Bio (1 mentions)
Ez dna methylation lightning kit, by Zymo Research (1 mentions)
Human cd4 cd25 regulatory t cell isolation kit, by Miltenyi Biotec (1 mentions)
Epitect fast dna bisulfite kit, by Qiagen (1 mentions)
Quantity one basic software, by Bio-Rad (1 mentions)
Pyromark pcr kit, by Qiagen (1 mentions)
Gotaq polymerase, by Promega (1 mentions)
Pyromark assay design 2, by Qiagen (1 mentions)
Epitect bisulfite kit, by Qiagen (1 mentions)
Pyromark assay kit, by Qiagen (1 mentions)
6 protocols using pyromark q24 kit
1
Pyrosequencing Methylation Analysis of Sperm DNA
2
Bisulfite Pyrosequencing of Sperm DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
F1 sperm derived DNA sample of the four conditions tested (C57BL/6J controls and DEHP 300, FVB/N controls and DEHP 300) were analyzed by bisulfite pyrosequencing using six independent samples per conditions except for C57BL/6J DEHP 300 where 2 triplicates were used instead of the six independent samples due to a lake of sufficient remaining samples. DNA was subjected to bisulfite treatment using EZ DNA Methylation-Lightning kit with respect to the manufacturer recommendations (Zymo Research, USA). PCR was performed using the Takara EpiTaq HS (Takara Bio Inc., R110Q). PCR products were immobilized onto streptavidin-coated sepharose beads (Fisher Scientific, ref 17-5113-01) reacting with primer incorporated biotin before being subject to single strands preparation using a Vacuum preparation tool (Biotage) as following the process previously described [41 (link)]. The resulting single stranded DNA molecules were then sequenced in a PyroMark Q24 instrument (Qiagen) using appropriate enzymes, substrates and nucleotides form the PyroMark Q24 kit (Qiagen, reference number 970922). Nucleotide dispensation was according to “Method 011” as recommended for the cartridge we receive (Qiagen, catalogue number 979202). Methylation levels at CpG sites were automatically determined by the instrument. Primers and assays related sequences are provided in supplementary (S1 Table ).
3
Analyzing Epigenetic Regulation in T-cell Subtypes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human T-cells (CD4+CD25− and CD4+CD25+) were isolated using the human CD4+CD25+ Regulatory T Cell Isolation Kit (Miltenyi Biotec). Genomic DNA isolated from human T-cell subpopulations was extracted, bisulfite converted, and purified using the EpiTect Fast DNA Bisulfite Kit (Qiagen) according to the recommendations of the manufacturer. For amplification of specific CpG regions with the Foxp3 gene, 20 ng of bisulfite-converted DNA was used as a template in a PCR set up with the PyroMark PCR Kit (Qiagen). Different subsets of amplification primer pairs (Supplemental Table S2) were used. Methylation of specific CpGs was assessed by pyrosequencing of PCR products with the PyroMark Q24 kit (Qiagen) according to the recommendations of the manufacturer. Sequencing primers for the different regions are indicated in Supplemental Table S3. COBRA was carried out using the same bisulfite-converted DNA-templates (60 ng) as described for pyrosequencing. The relevant COBRA primer pairs used in subsequent PCRs with GoTaq polymerase (Promega) are indicated in Supplemental Table S4. PCR products were digested with TaqI (Thermo Scientific, Schwerte, Germany) for 3.5 h at 65°C according to the recommendations of the manufacturer. Band intensities of undigested and digested PCR fragments were compared and quantified with Quantity One Basic software (Bio-Rad).
4
Pyrosequencing Protocol for DNA Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the current study, pyrosequencing was performed as described previously using the PyroMark Q24 kit (Qiagen, Hilden, Germany) [27 (link)]. Briefly, PCR reactions were carried out in a 25 μL final volume comprising 12.5 μL of PyroMark Master Mix, 2.5 μL of CoralLoad buffer, 0.5 μL of forward and biotinylated reverse primers (0.2 μM final concentration), 8 μL of RNase-free water, and 1 μL of bisulfite-treated DNA (20 ng). The biotinylated PCR products were processed as described elsewhere [31 (link)]. Results were analyzed using PyroMark Q24 2.0.6 software. To ensure successful bisulfite conversion of unmethylated cytosines, an internal conversion control that corresponded to the position of a non-CG cytosine (not subject to methylation) was present in the dispensation sequence. Of the 241 samples analyzed, one sample (0.4 %) did not show a result. The sequences for the genomic region of pyrosequencing primers are provided in Additional file 1 : Table S1.
5
Validating Methylation Profiles in Sperm Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bisulfite pyrosequencing was used to validate differential methylation at the promoter region of GDF2. Here, baseline sperm DNA samples prior to any treatments were analyzed from CC (n = 8) and TC (n = 5) cohorts of our main study, as well the Italian validation cohort. For pyrosequencing assays, sperm DNA (200–500 ng) underwent bisulfite conversion with the EpiTect Bisulfite Kit (Qiagen) according to the manufacturer’s protocol. Primers were designed (PyroMark Assay Design 2.0, Qiagen) to overlap the areas where differential methylation was observed following 450 K array analysis; two sets of PCR primers, using a total of five sequencing primers, were designed in order to analyze a total of 21 CpG sites (Additional file 1 : Table S6). Bisulfite PCR was conducted, and pyrosequencing was performed as previously described [69 ] using the PyroMark Q24 kit (Qiagen) as per the manufacturer’s protocol.
6
LINE-1 CpG Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from mouse samples and evaluated for the status of methylation in CpG dinucleotides located in the L1 region. The 5′UTR region upstream of ORF1 in the LINE-1 element was PCR amplified and analyzed for DNA methylation using the Qiagen PyroMark assay kit (Qiagen, USA) [20 ]. The primer sets (5′-biotin-labeled) used for PCR amplification were: Fwd: CCAGCTGGGGAGGCGGCCTA, Rev: CTGGTAATCTCTGGAGTT and the sequencing probe used was: GCCACAGCAGCAG. Briefly, the PCR products were suspended using the PyroMark Q24 kit (Qiagen) following the manufacturer’s protocol, and the methylation status was quantified with an estimated score of 0–100, with 0 being no methylation and 100 representing complete methylation for all of the CpG dinucleotides in the region. The threshold in the assay was >5%.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!