Sybr green rt qpcr kit

Tissues and cultured cells were used for total RNA extraction using Trizol reagent (Invitrogen). SYBR Green RT‐qPCR kit (Takara, Shiga, Japan) was applied for RT‐PCR reactions. Total RNAs of TPC‐1 and KAT‐5 cells were incubated for 30 min with 3 U/mg of RNase R or mock at 37°C. The relative levels of circPTPRM and PTPRM mRNA were quantified by qRT‐PCR analysis. The following sequences of the primers were used for qPCR (5′‐3′): circPTPRM forward: GGGCATCTTGCTGTTCGTGA, reverse: TTCAGTGGGAACAGCACCTG; PTPRM forward: GGCGAGACGTTCTCAGGTG, reverse: AGAAGTCGGTTTAGTCAAGGTGT; miR‐885‐5p forward: GTCCATTACACTACCCTGCCTC, reverse: CGCGAGCACAGAATTAATACG; DNMT3A forward: TATTGATGAGCGCACAAGAGAGC, reverse: GGGTGTTCCAGGGTAACATTGAG; GAPDH forward: TGTGGGCATCAATGGATTTGG, reverse: ACACCATGTATTCCGGGTCAAT; U6 forward: AAAGCAAATCATCGGACGACC, reverse: GTACAACACATTGTTTCCTCGGA. Fold changes of expression levels were calculated by the 2^−ΔΔCt method.

Total RNA was extracted by TRIzol agent (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to the manufacturer’s instructions, and 1 μg RNA was used to synthesize cDNA with the PrimeScript RT Reagent kit (Takara Bio Inc., Dalian, China). RT-qPCR was performed using a SYBR Green RT-qPCR kit (Takara Bio Inc.) on an ABI Prism 7500 real-time PCR system (Applied Biosystems, Foster City, CA, USA). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal reference. The qPCR system (20 μl) contained 10 μl SYBR EX Taq‑Mix, 1 μl forward and reverse primers, 1 μl cDNA, and 8 μl ddH₂O. PCR primers are shown in Table 1, and PCR conditions were: initial denaturation at 95°C for 5 minutes, followed by 40 cycles of 95°C for 15 s and 60°C for 1 minute. The relative expression of mRNA was determined with the 2^−ΔΔCt method.

RNA was extracted using TRIzol^® RNA Isolation Reagents (Invitrogen; Thermo Fisher Scientific, Inc.) and cDNA was generated with SuperScript™ II reverse transcriptase according to the manufacturer's protocol (Invitrogen; Thermo Fisher Scientific, Inc.). A total of 2–5 µg RNA was mixed with reverse transcriptase and incubated at 42°C for 50 min to synthesize cDNA. The mRNA levels of mouse brain tissues, primary mouse neuronal cells or PC12 cells exposed to OGD/R were evaluated using a SYBR-Green RT-qPCR kit (Takara Biotechnology Co., Ltd., Dalian, China). qPCR was conducted using a CFX96 Touch™ RT PCR Detection System (Bio-Rad Laboratories, Inc., Hercules, CA, USA) as follows: Denaturation at 95°C for 10 sec, primer annealing at 60°C for 20 sec and elongation at 72°C for 30 sec, for 40 cycles. The mouse and rat-specific primers designed are presented in Table I. The relative quantification of each target gene was normalized to GAPDH using the 2^−∆∆Cq quantification method (23 (link)), and the fold change between sham and control group was calculated with three replicates in each group.

Cells were trypsinized and lysed with 1 ml TRIzol (Thermo Fisher Scientific Inc., Waltham, MA, USA). Following lysis, total RNA was extracted using the phenol chloroform method (27 (link)). RNA purity was determined at A260/A280 using an ultraviolet spectrophotometer (Nanodrop ND1000; Thermo Scientific, Inc.). cDNA was obtained from 1 µg RNA following reverse transcription with a PrimeScript RT Reagent kit (Takara Biotechnology, Co., Ltd., Dalian, China) and stored at −20°C. qPCR was performed using a SYBR Green RT-qPCR kit (Takara Biotechnology Co., Ltd.) and GAPDH was used as an internal reference. The qPCR system (20 µl) consisted of 10 µl SYBR EX Taq-Mix, 0.5 µl forward primer (CLDN1, 5′-CTGGGAGGTGCCCTACTTTG-3′; GAPDH, 5′-AGAAGGCTGGGGCTCATTTG-3′), 0.5 µl reverse primer (CLDN1, 5′-ACACGTAGTCTTTCCCGCTG-3′; GAPDH, 5′-AGGGGCCATCCACAGTCTTC-3′), 1 µl cDNA and 8 µl ddH₂O. qPCR was performed in triplicate for each sample. The thermocycling conditions for qPCR were: Initial denaturation at 95°C for 5 min; 40 cycles of denaturation at 95°C for 1 min, annealing at 60°C for 30 sec, elongation at 72°C for 20 sec and final extension at 72°C for 1 min. The 2^−ΔΔCq method was used to determine the relative expression of mRNA (28 (link)).