293t cells

Lentiviral sh-METTL14, sh-UBR1, sh-YTHDF1, sh-YTHDF2, and/or NCS (GenePharma) were transfected into PC12 cells. The cells were treated with TBHP for 48 h after transfection. The lentiviruses were generated. Specifically, the overexpression (LV-UBR1) or silencing (sh-UBR1: UUGUACAUUCUCUUCUUGCUU; sh-METTL14: AAGUUUCUCUUGUUUCAGCGA; sh-YTHDF1: UUAUUCUCUUGUCCUUUUGUU; sh-YTHDF2: UCAAGUAAGGUUCGAAAUCAU) sequences of the target genes were designed and synthesized. Subsequently, the amplified sequences were inserted into lentiviral vectors (LV6 was used as the overexpression vector and LV-1 as the knock-down vector), and positive clones were confirmed by sequencing to obtain recombinant plasmids. Tool vector plasmids carrying target genes and helper plasmids (for lentivirus packaging) were transfected into 293T cells by GenePharma and cultured for 6 h. The medium was then replaced with complete medium. Seventy-two hours later, cell supernatants were collected, purified, and condensed. The acquired liquid was subjected to a viral titer test at 10⁸ TU/ml.

The AKR1B10-targeting shRNA and its negative control shRNA (shNC) constructed in the LV2 lentiviral vector, and lentiviral particles expressing luciferase infused shRNA were packaged in 293T cells (GenePharma, Suzhou, China). The sequences of shRNAs were 5’-CACGCATTGTTGAGAACAT-3’(sh1) and 5’-GTGCCTATGTCTATCAGAA-3’ (sh2). The target sequences of AKR1B10 plasmid were referred to its genetic sequence in the PubMed (https://www.ncbi.nlm.nih.gov/gene). Transfection was carried out as directed by the manufacturer. The knockdown or overexpression efficiency was validated by western blot analysis.

A549 cells with stable sh-circ_0017109 expression were generated by lentiviral transduction. pLKO.1-Puro lentiviral vector with circ_0017109 shRNA or scramble control shRNA (sh-NC) was provided by Genomeditech Co., Ltd. (Shanghai, China). The production of lentivirus was conducted in 293 T cells by GenePharma Co. Ltd. (Shanghai, China). Cells infected with lentivirus were selected with 800 ng/mL puromycin for 2 weeks before inoculation. Adult BALB/c nude mice (~ 25–30 g) were provided by National Resource Center for Mutant Mice of China (Nanjing, China). Nude mice were raised in a controlled environment at 22 °C with 12 h light/dark cycle. The animals were assigned to two groups (n = 6 each). To establish mouse xenograft model of NSCLC, each mouse was injected with 2 × 10⁶ A549 cells (stable expression of circ_0017109 shRNA or sh-NC) in PBS (150 μL) subcutaneously via flanks. Tumor size was measured every week using a caliber. After 4 weeks, euthanasia of mice was performed using 20% of carbon dioxide in a closed chamber for 15 min until no movement was observed. Tumor was then dissected for subsequent analysis. All the animal experimental protocols were conducted in compliance with animal use and care guidelines of Tianjin Medical University Cancer Institute and Hospital, and were approved by the corresponding animal experimental committee.

293T cells were obtained from Procell Life Science & Technology Co., Ltd (Wuhan, China). 293T cells were transfected with miR-6132 mimics, inhibitor or respective negative control (GenePharma, Shanghai, China). The transfected cells were cultured in RPMI 1640 culture medium and harvested for 24 h. The sequences used in this study are listed in Table 2.