Supernatants of in vitro cell cultures were analyzed by ELISA using a commercial assay system (eBioScience). For qRT-PCR, total RNA was isolated using TRI reagent (Molecular Research Center, Inc.) and subjected to cDNA synthesis using RNase H-reverse transcriptase (Invitrogen) and oligo (dT) primers. qRT-PCR was performed in triplicates, using iCycler Sequence Detection System (Bio-Rad) and iQTM SYBR Green Supermix (Bio-Rad). The expression of individual genes was calculated by a standard curve method and normalized to the expression of Actb. The gene-specific PCR primers (all for mouse genes) are shown in Supplementary Table 1 .
Icycler sequence detection system
Manufactured by Bio-Rad
The iCycler Sequence Detection System is a real-time PCR instrument designed for gene expression analysis, genotyping, and pathogen detection. It features a thermal cycler, optics, and software for data analysis. The system allows for precise quantification of nucleic acid targets in real-time.
Automatically generated - may contain errors
Lab products found in correlation
Iqtm sybr green supermix, by Bio-Rad (11 mentions)
Rnase h reverse transcriptase, by Thermo Fisher Scientific (7 mentions)
Iq sybr green supermix, by Bio-Rad (6 mentions)
Trizol reagent, by Molecular Research Center (5 mentions)
Tri reagent, by Molecular Research Center (4 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (4 mentions)
Tri reagent, by Thermo Fisher Scientific (4 mentions)
Rnase h reverse transcription, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Qiagen (1 mentions)
Iscript reverse transcriptase, by Bio-Rad (1 mentions)
Sybr green pcr master mix, by Bio-Rad (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Trizol reagent, by Merck Group (1 mentions)
Itaq sybr green supermix with rox, by Bio-Rad (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Iq sybr green supermix kit, by Bio-Rad (1 mentions)
21 protocols using icycler sequence detection system
1
Gene Expression Analysis by qRT-PCR
2
Gene Expression Analysis in Macrophages and Intestinal Tissues
3
Quantitative Real-Time PCR of Microglia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time qRT-PCR was performed as previously described (46 (link)). Total RNA was isolated from microglia cells using TRI reagent (Invitrogen) and subjected to complementary DNA synthesis using Moloney Murine Leukemia Virus (MMLV) reverse transcriptase (Invitrogen) and oligo(dT) primers. Real-time qRT-PCR was performed using the iCycler Sequence Detection System (Bio-Rad, Hercules, CA) and iQ SYBR Green Supermix (Bio-Rad). The expression of individual genes was calculated by a standard curve method and was normalized to the expression of β-actin. The primers used in qRT-PCR assays are shown in table S1.
4
Quantification of Type I Interferons
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol reagent (Molecular Research Center, Inc.) and subjected to cDNA synthesis using RNase H-reverse transcriptase (Invitrogen) and oligo (dT) primers. qRT-PCR was performed in triplicates, using iCycler Sequence Detection System (Bio-Rad) and iQTM SYBR Green Supermix (Bio-Rad). The expression of individual genes was calculated by a standard curve method and normalized to the expression of Actb. The mouse gene-specific PCR primers are used as follows: Actb forward primer: 5′CGTGAAAAGATGACCCAGATCA, Actb reverse primer: 5′CACAGCCTGGATGGCTACGT3′; Ifnb forward primer: 5′AGCTCCAAGAAAGGACGAACAT3′, Ifnb reverse primer: 5′GCCCTGTAGGTGAGGTTGATCT3′; and Ifna forward primer: 5′TGACCTCAAAGCCTGTGTGATG3′, Ifna reverse primer: 5′AAGTATTTCCTCACAGCCAGCAG3′.
5
Quantitative RT-PCR Analysis of Inflammatory Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Supernatant cell cultures were collected and analyzed using ELISA (eBioScience, San Diego, California). Total RNA was extracted using TRIzol reagent (Qiagen, Valencia, California). Complementary DNA synthesis was performed using RNase H-reverse transcriptase (Invitrogen, Waltham, Massachusetts) and oligo (dT) primers. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) was performed with iQTM SYBR Green Supermix (Bio-Rad, Hercules, California) using the iCycler Sequence Detection System (Bio-Rad). The expression of target genes was quantified by a standard curve method and normalized to Actb.
The primers were as follows: IL-6: 5ʹ-CTGATGCTGGTGACAACCAC-3ʹ (forward), 5ʹ-CAGACTTGCCATTGCACAAC-3ʹ (reverse); TNF: 5ʹ-CATCTTCTCAAAATTCGAGTGACAA-3ʹ (forward), 5ʹ-CCAGCTGCTCCTCCACTTG-3ʹ (reverse); IL-1β: 5ʹ-TGGACCTTCCAGGATGAGGACA-3ʹ (forward), 5ʹ-GTTCATCTCGGAGCCTGTAGTG-3ʹ (reverse); Nos2: 5ʹ-GAGACAGGGAAGTCTGAAGCAC-3ʹ (forward), 5ʹ-CCAGCAGTAGTTGCTCCTCTTC-3ʹ (reverse); and RasGRP1: 5ʹ-CTTCAACACGCTGATGGCTGTG-3ʹ (forward), 5ʹ-GGACAGCAGTTCAGTCATCTCG-3ʹ (reverse).
The primers were as follows: IL-6: 5ʹ-CTGATGCTGGTGACAACCAC-3ʹ (forward), 5ʹ-CAGACTTGCCATTGCACAAC-3ʹ (reverse); TNF: 5ʹ-CATCTTCTCAAAATTCGAGTGACAA-3ʹ (forward), 5ʹ-CCAGCTGCTCCTCCACTTG-3ʹ (reverse); IL-1β: 5ʹ-TGGACCTTCCAGGATGAGGACA-3ʹ (forward), 5ʹ-GTTCATCTCGGAGCCTGTAGTG-3ʹ (reverse); Nos2: 5ʹ-GAGACAGGGAAGTCTGAAGCAC-3ʹ (forward), 5ʹ-CCAGCAGTAGTTGCTCCTCTTC-3ʹ (reverse); and RasGRP1: 5ʹ-CTTCAACACGCTGATGGCTGTG-3ʹ (forward), 5ʹ-GGACAGCAGTTCAGTCATCTCG-3ʹ (reverse).
6
Quantification of gene expression via ELISA and qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Supernatants of in vitro cell cultures were analyzed via ELISA using a commercial assay system (eBioScience). For qRT-PCR, total RNA was isolated using TRIzol reagent (Molecular Research Center, Inc.) and subjected to cDNA synthesis using RNase H-reverse transcriptase (Invitrogen) and oligo (dT) primers. qRT-PCR was performed in triplicate using an iCycler Sequence Detection System (Bio-Rad) and iQTM SYBR Green Supermix (Bio-Rad). The expression of individual genes was calculated with a standard curve and normalized to the expression of Actb. The gene-specific PCR primers (all for mouse genes) are shown in Supplementary Table 1 .
7
Quantitative Real-Time PCR Analysis
8
Real-time PCR Analysis of Cholesterol Pathway
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was performed using a Bio-Rad iCycler sequence detection system (Bio-Rad). The primers of the VLDL receptor, LDL receptor, and HMGCR are shown in Table 3 . The reaction was added to 0.1 mL PCR strip tubes and were set by mixing 12.5 μl iQ™ SYBR® Green Supermix (BIO-RAD), with 1 μl cDNA, 0.5 μl primer (R), 0.5 μl primer (F), and 10.5 μl sterilized water. The plate was sealed and performed using a detector (iQ5 Multicolor Real-Time PCR Detection System). All volumes were normalized to β-actin expression (GenBank accession no. X00351) mRNA. The number of PCR cycles was defined as the mRNA levels and were quantified by use of the CT value [34 (link)].
| Gene | Primer sequence | Size (bp) | Tm (°C) |
|---|---|---|---|
| VLDL receptor | (F)ACCTCTGGCCAAATATGCAC | 304 | 58.9 |
| (R)CACTCAGTCTTTGCAAACCTCC | |||
| LDL receptor | (F)GCGTCCCTGTACAGATAGTGG | 284 | 63.3 |
| (R)GCCACTCATACATACAACGG | |||
| HMG-CoA reductase | (F)CCACGAACGCTCTTAGCTTTC | 215 | 57.1 |
| (R)CTAAGAGGCTCTCCATGCTGC | |||
| β-actin | (F)GGATGCAGAAGGAGATCACTG | 90 | |
| (R)CGATCCACACGGAGTACTTG |
9
Gene Expression Analysis by qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Supernatants of in vitro cell cultures were analyzed by ELISA using a commercial assay system (eBioScience). For qRT-PCR, total RNA was isolated using TRI reagent (Molecular Research Center, Inc.) and subjected to cDNA synthesis using RNase H-reverse transcriptase (Invitrogen) and oligo (dT) primers. qRT-PCR was performed in triplicates, using iCycler Sequence Detection System (Bio-Rad) and iQTM SYBR Green Supermix (Bio-Rad). The expression of individual genes was calculated by a standard curve method and normalized to the expression of Actb. The gene-specific PCR primers (all for mouse genes) are shown in Supplementary Table 1 .
10
Quantitative RT-PCR Analysis of Macrophage Cytokines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA from BMDMs was extracted by TRIzol reagent (Sigma). Then reverse transcription was completed using the PrimeScript™ RT Reagent Kit (Takara) to obtain complementary DNA. The quantitative polymerase chain reaction (PCR) reactions were set up using iQTM SYBR Green Supermix (Bio‐Rad) and subjected to the iCycler Sequence Detection System (Bio‐Rad). Primers used for real‐time PCR included: IL‐6 forward 5′‐CTGATGCTGGTGACAACCAC‐3′, reverse 5′‐CAGACTTGCCA TTGCACAAC‐3′; IL‐23a forward 5′‐CATGCTAGCCTGGAACGCACAT‐3′, reverse 5′‐ACTGGCTGTTGT CCTT GAGTCC; TNF‐α forward 5′‐CATCTTCTCAAAATTCGAGTGA CAA‐3′, reverse 5′‐CCAGCTGCTCCTCCACTTG; Arg1 forward 5′‐CATTGGCTTGCGAG ACGTAGAC‐3′, reverse 5′‐GCTGAAGGTCTCTTCCATCACC‐3′; Mrc1 forward 5′‐GTT CACCTGGAGTGA TGGTTCTC‐3′, reverse 5′‐AGGACATGCCAGGGTCACCTTT‐3′. β‐Actin forward 5′‐GAAATCGT GCGTGACATCAA AG‐3′; reverse 5′‐TGTAGTTTCATGGA TGCCACAG‐3′. The relative expression was normalized to β‐actin expression using the 2‐∆∆Ct method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!