Symphony s6

Manufactured by BD

Sourced in United States

The BD Symphony S6 is a flow cytometry system designed for high-performance cell analysis and sorting. It features a compact and modular design with up to six lasers, allowing for the simultaneous detection of multiple fluorescent parameters. The instrument is equipped with advanced optics and electronics to provide reliable and accurate data measurements.

Automatically generated - may contain errors

Lab products found in correlation

Efluor 780, by Thermo Fisher Scientific (2 mentions) Foxp3 fixation permeabilization kit, by Thermo Fisher Scientific (2 mentions) Facs aria 2 or 3, by BD (2 mentions) Facsymphony, by BD (2 mentions) Efluor 506, by Thermo Fisher Scientific (2 mentions) Novosampler pro, by Agilent Technologies (1 mentions) Cd3 fitc, by BioLegend (1 mentions) Cd45 percp cyanine 5, by BioLegend (1 mentions) Facsdiva software, by BD (1 mentions) Matrigel dome, by Corning (1 mentions) Prism 8, by GraphPad (1 mentions) Live dead yellow, by Thermo Fisher Scientific (1 mentions) Golgistop, by BD (1 mentions) Golgiplug, by BD (1 mentions) Fortessa, by BD (1 mentions) Cytofix, by BD (1 mentions) Lipofectamine crisprmax transfection reagent, by Thermo Fisher Scientific (1 mentions) Live dead staining kit, by Thermo Fisher Scientific (1 mentions)

7 protocols using symphony s6

ITGB1 KO Cell Sorting and Immune Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

To analyze and sort out ITGB1 KO cells, infected cells were first filtered through a cell strainer cap (35-μm mesh) to obtain a single cell suspension (approximately 1×10⁶ cells/mL for analysis and 1×10⁷ cells/mL for sorting), which was then labeled with APC-conjugated anti-human ITGB1 antibody (#10587-MM05-A, Sino Biological, China) by incubating for 30 min in the dark at room temperature.
To detect any changes in immune cell profile in mouse blood, 50μL of whole blood was mixed with 0.5μL of each of CD45-PerCP/Cyanine5.5, CD3-FITC, and CD8-AF700 antibodies (Biolegend, USA), and incubated for 30min at room temperature, followed by incubation with 500μL of red blood cell (RBC) lysis solution for 5min at room temperature.
Antibody-labeled cells were then sorted on a fluorescence-activated cell sorter (FACS) SymphonyS6 (BD Biosciences, USA) and analyzed using FACSDiva software (BD Biosciences, USA). Flow cytometry (FCM) was carried out on a NovoSampler Pro or a NovoSampler Q (ACEA Biosciences, USA) system, and data were analyzed using the NovoExpress v1.4.1 software (ACEA Biosciences, USA).

Zhang J., Song H., Dong Y., Li G., Li J., Cai Q., Yuan S., Wang Y, & Song H. (2023). Surface Engineering of HEK293 Cell-Derived Extracellular Vesicles for Improved Pharmacokinetic Profile and Targeted Delivery of IL-12 for the Treatment of Hepatocellular Carcinoma. International Journal of Nanomedicine, 18, 209-223.

+ Open protocol

+ Expand

Isolation and Organoid Culture of Endometrial Epithelial Subsets

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fluorescence Activated Cell Sorting (FACS) was performed to isolate MUC5B⁺ and MUC5B⁻ epithelial cells from endometrium dissociated tissue (Extended Data Figure 10). Briefly, control eutopic tissue was dissociated as described above. Cells were then stained with PI and with antibodies marking immune cells (CD45⁺), endothelial cells (CD31⁺), epithelial cells (EpCAM⁺), and MUC5B (Supplementary Table 10). We sorted both MUC5B⁺ and MUC5B⁻ epithelial cells (BD Bioscience Symphony S6), gated using FACS Diva (9.0.1), and plated 2000 cells of each population in Matrigel domes (Corning, #356231). Growth of organoid was monitored every 4 hours using an Incuycte S5 (Sartorius) live microscope on brightfield imaging for 10 days. Organoid area and counts were analyzed directly in the onboard Incucyte software (Source Data ED9) and a paired t-test was performed with GraphPad PRISM8 for each timepoint.

Tan Y., Flynn W.F., Sivajothi S., Luo D., Bozal S.B., Davé M., Luciano A.A., Robson P., Luciano D.E, & Courtois E.T. (2022). Single cell analysis of endometriosis reveals a coordinated transcriptional program driving immunotolerance and angiogenesis across eutopic and ectopic tissues. Nature cell biology, 24(8), 1306-1318.

+ Open protocol

+ Expand

Multiparametric Flow Cytometry Staining

Check if the same lab product or an alternative is used in the 5 most similar protocols

For staining of cell surface molecules, cells were suspended in staining buffer (PBS, 1% bovine serum albumin (BSA), and 0.01% NaN 3 ) and first stained with using PE-or APCconjugated MR1 tetramers at a dilution of 1:300 in staining buffer for 45 minutes at room temperature followed by surface staining with fluorochrome-conjugated antibody at 0.1-1 μg/10 7 cells. Cells were stained with Live/Dead Yellow (ThermoFisher) at 1:500 and Fc receptors were blocked with 2.4G2 antibody at 1:500 and Free Streptavidin at 1:1000 for 15 min at 4˚C. After washing, cells were stained with cell surface-specific antibodies for 30 minutes on ice. For cytokine staining, cells were previously stimulated with 100 ng/ml of PMA and 1 μg/ml of Ionomycin for 1h at 37˚C and then incubated in GolgiStop and GolgiPlug (both from BD PharMingen) for 2 h at 37˚C. For intracellular staining, cells were fixed with CytoFix (BD) for 20 min, and permeabilized with Perm 1X solution (ThermoFisher) with intracellular antibodies overnight. For high-parameter flow cytometry experiments, data were acquired on Fortessa or Symphony S6 (BD Biosciences), data were processed with DIVA (BD Bioscience) and analyzed with FlowJo v10.7 (BD). Opt-tSNE and UMAP dimensional reduction as well as FlowSOM algorithm clustering of flow cytometry data was performed in OMIQ software (OMIQ Inc.).

Chandra S., Ascui G., Riffelmacher T., Chawla A., Ramírez-Suástegui C., Castelan V.C., Seumois G., Simon H., Murray M., Seo G., Premlal A.L.R., Verstichel G., Li Y., Lin C., Greenbaum J., Lamberti J.J., Murthy R., Nigro J.J., Cheroutre H., Ottensmeier C.H., Hedrick S.Μ., Lu L., Vijayanand P., & Kronenberg M. (2021). Transcriptomes and metabolism define mouse and human MAIT cell heterogeneity.

+ Open protocol

+ Expand

Multiparameter Flow Cytometry Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were pre-incubated with 2.4G2 antibody (Bioceros) to block Fc receptors and stained with appropriate antibodies at 4°C in the dark for 30-45 minutes. Cell viability was assessed using Fixable Viability dyes (eFluor780 or eFluor506; Thermo Fischer) and cell suspensions were analyzed with a BD FACSymphony or purified using a BD Symphony S6, BD FACSAria II or III. Nuclei were sorted on basis of DAPI positivity and size. Analysis was performed with FlowJo software (BD). Intracellular staining for CD207 was performed by fixing and permeabilizing extracellularly stained cells according to the manufacturer’s instructions using the FoxP3 Fixation/Permeabilization Kit (Thermo Fischer).

Guilliams M., Bonnardel J., Haest B., Vanderborght B., Wagner C., Remmerie A., Bujko A., Martens L., Thoné T., Browaeys R., De Ponti F.F., Vanneste B., Zwicker C., Svedberg F.R., Vanhalewyn T., Gonçalves A., Lippens S., Devriendt B., Cox E., Ferrero G., Wittamer V., Willaert A., Kaptein S.J., Neyts J., Dallmeier K., Geldhof P., Casaert S., Deplancke B., ten Dijke P., Hoorens A., Vanlander A., Berrevoet F., Van Nieuwenhove Y., Saeys Y., Saelens W., Van Vlierberghe H., Devisscher L, & Scott C.L. (2022). Spatial proteogenomics reveals distinct and evolutionarily conserved hepatic macrophage niches. Cell, 185(2), 379-396.e38.

+ Open protocol

+ Expand

CRISPR-Mediated FBXW7 Knockout in MCF10A Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Edit‐R gene editing methods (Horizon, Waterbeach, UK) were used to engineer MCF10A FBXW7 mutant cells. In brief, cells were seeded at a density of 1 × 10⁶ cells per well in a 6‐well plate, along with 40 μm Edit‐R Cas9 nuclease protein NLS (Horizon), 20 μm crRNA, 10 μm tracrRNA and Lipofectamine™ CRISPRMAX transfection reagent (Cat #CMAX00003, Thermo Fisher Scientific, Waltham, MA, USA). The transfection was performed as per the manufacturer's instructions. A set of 3 crRNA (SQ‐004264‐01‐0002, Horizon) to target FBXW7 was utilised. 96 h following transfection, cells were seeded in antibiotic‐free media at a density of one cell per well into 96‐well plates, using a FACS sorter (BD Symphony S6, Franklin Lakes, NJ, USA). To assess for successful gene targeting events, genomic DNA surrounding the guide target site was amplified using forward 5′‐AGGGCCCAAATTCACCAATA‐3′ and reverse 5′‐TAACTGGAGGCGAGGAGAAC‐3′ primers. PCR products were subsequently cloned into pCR‐TOPO‐blunt (Cat #450245, Thermo Fisher Scientific) afterwhich Sanger sequencing of the inserts was performed.

Baxter J.S., Brough R., Krastev D.B., Song F., Sridhar S., Gulati A., Alexander J., Roumeliotis T.I., Kozik Z., Choudhary J.S., Haider S., Pettitt S.J., Tutt A.N, & Lord C.J. (2023). Cancer‐associated FBXW7 loss is synthetic lethal with pharmacological targeting of CDC7. Molecular Oncology, 18(2), 369-385.

+ Open protocol

+ Expand

Investigating FABP5 Expression in RSL3-Treated Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were treated with 200 nM RSL3 for 0, 1, 3, 5 and 7 h. After treatment, the cells were harvested and washed once with MACS buffer (D-PBS + 2 mM EDTA + 0.5% BSA) before stained with live-dead staining kit for 15 min (Invitrogen). After live-dead staining, the cells were washed once with MACS buffer, incubated with primary FABP5 antibody (Thermo Fisher Scientific) for 30 min, followed by two times MACS buffer washes and further incubation with the secondary antibody for 30 min at room temperature (Biolegend). After washing with MACS buffer two times, the cells were analyzed by flow cytometry (BD Symphony S6).

Peng H., Xin S., Pfeiffer S., Müller C., Merl-Pham J., Hauck S.M., Harter P.N., Spitzer D., Devraj K., Varynskyi B., Arzberger T., Momma S, & Schick J.A. (2024). Fatty acid-binding protein 5 is a functional biomarker and indicator of ferroptosis in cerebral hypoxia. Cell Death & Disease, 15(4), 286.

+ Open protocol

+ Expand

Flow Cytometry-based Immune Cell Phenotyping

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were pre-incubated with 2.4G2 antibody (Bioceros) to block Fc receptors and stained with appropriate antibodies at 4°C in the dark for 30-45 minutes. Cell viability was assessed using Fixable Viability dyes (eFluor780 or eFluor506; Thermo Fischer) and cell suspensions were analyzed with a BD FACSymphony or purified using a BD Symphony S6, BD FACSAria II or III.
Nuclei were sorted on basis of DAPI positivity and size. Analysis was performed with FlowJo software (BD). Intracellular staining for CD207 was performed by fixing and permeabilizing extracellularly stained cells according to the manufacturer's instructions using the FoxP3 Fixation/Permeabilization Kit (Thermo Fischer).

Guilliams M., Bonnardel J., Haest B., Vanderborght B., Bujko A., Martens L., Thoné T., Browaeys R., Ponti F.F.D., Remmerie A., Wagner C., Vanneste B., Zwicker C., Vanhalewyn T., Gonçalves A., Lippens S., Devriendt B., Cox E., Ferrero G., Wittamer V., Willaert A., Kaptein S.J.F., Neyts J., Dallmeier K., Geldhof P., Casaert S., Deplancke B., Dijke P.t., Hoorens A., Vanlander A., Berrevoet F., Nieuwenhove Y.V., Saeys Y., Saelens W., Vlierberghe H.V., Devisscher L., & Scott C.L. (2021). Spatial proteogenomics reveals distinct and evolutionarily-conserved hepatic macrophage niches.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!