RNA samples separated by 11% WIDE Range Gel SDS-PAGE were transferred onto a Hybond-N+ membrane (GE Healthcare) and hybridized with biotinylated oligonucleotide(s) (IDT) complementary to the tRNAs shown below with the probe sequences: tRNAAsp: CCGCGACGGGGAATTGAACCCCGATCTG, tRNAAsn: CCCCAGTGAGGGTTGAACTCACGATCTT, 5SrRNA: ACCCACTACACTACTCGGTCAGGCTCTTAC. Hybridization experiments were performed using a NorthernMax kit (Ambion) and a Chemiluminescent Nucleic Acid Detection Module (Thermo Scientific) according to the manufacturer’s instructions. Images were visualized and analyzed by an LAS4000 LuminoImager (GE Healthcare).
Las4000 luminoimager
Manufactured by GE Healthcare
The LAS4000 LuminoImager is a laboratory imaging system designed for the detection and analysis of luminescent signals. It employs a highly sensitive CCD camera to capture images of chemiluminescent or bioluminescent samples. The system is capable of acquiring high-resolution images and provides tools for quantitative analysis of the luminescent data.
Automatically generated - may contain errors
Lab products found in correlation
Northernmax kit, by Thermo Fisher Scientific (2 mentions)
Hybond n membrane, by GE Healthcare (2 mentions)
Chemiluminescent nucleic acid detection module, by Thermo Fisher Scientific (2 mentions)
Hybond p, by GE Healthcare (1 mentions)
Anti mouse igg peroxidase conjugate, by Merck Group (1 mentions)
Ez link psoralen peg3 biotin, by Thermo Fisher Scientific (1 mentions)
3 protocols using las4000 luminoimager
1
tRNA and 5S rRNA Detection by Northern Blot
2
Western Blot Protein Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples were subjected to 11% WIDE Range Gel SDS-PAGE and transferred onto PVDF membrane (Hybond-P, GE Healthcare). Then, membrane was subjected to immunodetection using Anti 6 3 Histidine, Monoclonal Antibody (9C11, Wako) and anti-mouse IgG Peroxidase Conjugate (A4416, Sigma-Aldrich). Images were analyzed by LAS4000 lumino-imager (GE Healthcare).
3
Northern Blot Analysis of tRNA Isoacceptors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Samples separated by 11% WIDE Range Gel SDS-PAGE were transferred onto Hybond-N + membrane (GE healthcare) and hybridized with biotinylated oligonucleotide(s) complementary to the tRNAs shown below with the probe sequences; tRNA Asp : anti-aspTUV (CGGAACGGACGGGACTCGAACCCGCGACC), tRNA Glu : anti-gluTUVW (CGTCCCCTAGGGGATTCGAACCCCTGTTA), tRNA Ser : anti-serT (CGGAAGCGCAGAGATTCGAACTCTGGAAC) and anti-serU (CGGAGAGAGGGGGATTTGAACCCCCGGTA), tRNA Thr : anti-thrT (TGCTGATAGGCAGATTCGAACTGCCGACC) and anti-thrV (TGCTGATACCCAGAGTCGAACTGGGGACC), tRNA Cys : anti-cysT_v2 (TTCCGGAGTCGAACCGGACTAGACGGATTTGC). Hybridization experiments were performed using NorthernMax kit (Ambion) and Chemiluminescent Nucleic Acid Detection Module (Thermo Scientific) according to the manufacture's instruction. Biotinylation of oligodeoxynucleotides was carried out using EZ-Link Psoralen-PEG3-Biotin (Thermo Scientific). Images were visualized and analyzed by LAS4000 LuminoImager (GE Healthcare).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!