The largest database of trusted experimental protocols

Anti wtap

Manufactured by Santa Cruz Biotechnology

Anti-WTAP is a laboratory product developed by Santa Cruz Biotechnology. It is an antibody that can be used to detect the WTAP protein, which is involved in RNA processing and regulation. The core function of this product is to provide researchers with a tool to study the WTAP protein and its role in cellular processes.

Automatically generated - may contain errors

3 protocols using anti wtap

1

Western Blot Analysis of RNA Methylation Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mouse cerebellum and cerebral cortex were dissected as described above and triturated in RIPA buffer supplemented with protease and phosphatase inhibitors; 60–80 µg of tissue lysates were subjected to SDS-PAGE and western blot analysis. Primary antibodies used in our analysis are as follows: anti-METTL3 (Abnova, H00056339-B01P), anti-METTL14 (Atlas Antibodies, HPA038002), anti-ALKBH5 (Sigma, HPA007196), anti-WTAP (Santa Cruz, sc-55438), anti-FTO (Abcam, ab92821) and beta-ACTIN (Santa Cruz, sc-47778). Secondary antibodies used are as follows: peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG (H + L) (XiYA Biology, Beijing, FZ-4201), peroxidase-conjugated AffiniPure Goat Anti-Mouse IgG (H + L) (XiYA Biology, Beijing, FZ-4202) and peroxidase-conjugated AffiniPure Rabbit Anti-Goat IgG (H + L) (XiYA Biology, Beijing, FZ-4203).
+ Open protocol
+ Expand
2

Quantitative RT-PCR and Western Blot Analysis of mRNA and Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
For mRNA analysis, total RNA extraction for cDNA synthesis was conducted with the Taqman Reverse Transcription Reagent kit (TaKara-Bio, Kusatsu, Japan). Real-time quantitative PCR was conducted with different primer sequences (Table 1) using SYBR Green Master Mix (TaKaRa).

Primer sequences for real time RT-PCR

TargetForwardReverse
ACTBTCTTCCAGCCTTCCTTCCTAGCACTGTGTTGGCGTACAG
CAPRIN1TCTCGGGGTGATCGACAAGAACCCTTTGTTCATTCGTTCCTGG
SLC2A1TGTCTGGCATCAACGCTGTCTTCTC CCTGCTCGCTCCACCACAAAC
HK2CGACAGCATCATTGTTAAGGAGCA GCAGGAAAGACACATCACATTT
HIF1AAGTTCCGCAAGCCCTGAAAGCGCAGTGGTAGTGGTGGCATTAGC
MYCCGCCTCTTGACATTCTCCTCGGACTATCCTGCTGCCAAGA
NUP160GTTATCTGGCTGCTCTCAATTGGTGCATTCTCCATCATGATTCC
NUP133AGTACCTGTGGGCTGCTTCTCTAGGCTCTGGTTGTCAGTCTGCTCAC
NUP155CCGCTCCTCAGTCTCCCAGTGGCTCATCCTTGGATCGCTGTGAC
METTL3CCAGCACAGCTTCAGCAGTTCCGCGTGGAGATGGCAAGACAGATG
WTAPCTGACAAACGGACCAAGTAATGAAAGTCATCTTCGGTTGTGTTG
Proteins were separated by SDS–PAGE followed by Western blot as described previously [30 (link), 31 (link)]. Anti- GAPDH (Cell Signaling Technology), anti-Caprin-1 (116 kDa, ProteinTech Group), anti-HIF1α (120 kDa, ProteinTech Group), anti-c-Myc (49 kDa, roteinTech Group), anti-WTAP (45 kDa, Santa Cruz Biotechnology), and anti-METTL3 (64 kDa, Abcam) were used as primary antibodies. HRP-conjugated anti-mouse and anti-rabbit IgG (Cell Signaling Technology) were used as secondary antibodies.
+ Open protocol
+ Expand
3

Ferroptosis Pathway Regulators Evaluation

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following antibodies and reagents were used: anti-GPX4 (Boster, BM5231), anti-Fibronectin (Boster, BA1772), anti-Collagen-III (Bioss, bs-0549R), anti-WTAP (Santa Cruz Biotechnology, sc-374280), anti-METTL3 (Abcam, ab195352), anti-METTL14 (Bioss, bs-17608R), anti-ALKBH5(Proteintech, 16837-1-AP), anti-FTO (Bioss, bs-7056R), ferrostatin-1 (fer-1)(Selleck, S7243), Erastin, RSL3(Selleck, S8155), Z-VAD-FMK(Selleck, S7023) and Necrosulfonamide (Selleck, S8251).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!