Log In Sign up
The largest database of trusted experimental protocols

Copper sulfate

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in Germany, United States, India

Copper sulfate is a chemical compound commonly used in various laboratory applications. It is a crystalline solid with a blue color. Copper sulfate has the chemical formula CuSO4 and serves as a source of copper ions in experiments and analytical procedures.

Automatically generated - may contain errors

Lab products found in correlation

Edu additive buffer and reaction buffers, by Thermo Fisher Scientific (2 mentions) Af 647 azide, by Thermo Fisher Scientific (2 mentions) Bovine serum albumin (bsa), by Thermo Fisher Scientific (1 mentions) Sodium bicarbonate, by Thermo Fisher Scientific (1 mentions) Polyvinyl alcohol (pva), by Merck Group (1 mentions) Ethylenediaminetetraacetic acid, by Thermo Fisher Scientific (1 mentions) Sulfuric acid, by Thermo Fisher Scientific (1 mentions) Silver nitrate, by Thermo Fisher Scientific (1 mentions) Iminodiacetic acid ida, by Merck Group (1 mentions) Tris 2 carboxyethyl phosphine tcep, by Merck Group (1 mentions) Dithiothreitol (dtt), by Merck Group (1 mentions) Methanol, by Thermo Fisher Scientific (1 mentions) Acetonitrile, by Thermo Fisher Scientific (1 mentions) Ammonium acetate, by Thermo Fisher Scientific (1 mentions) Urea, by Merck Group (1 mentions) Deuterium oxide, by Merck Group (1 mentions) Imidazole, by Merck Group (1 mentions) Pepsin, by Merck Group (1 mentions) Zinc sulfate, by Merck Group (1 mentions) Potassium bromide, by Merck Group (1 mentions)

Close spelling variants of this product

Copper sulfate pentahydrate (7 citations) Copper (II) sulfate (7 citations) Copper (II) sulfate pentahydrate (5 citations) Copper(II) sulfate pentahydrate (CuSO4·5H2O, (4 citations) Copper sulfate (CuSO4.5H2O; (2 citations)

9 protocols using copper sulfate

1

Hybrid Membrane Fabrication and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols
Polyvinyl alcohol (Sigma Aldrich Chemical Company, St. Louis, MO, USA) was purchased as a fully hydrolyzed powder with an average molecular weight of 85,000 g/mol. For the hybrid method, CA membranes were commercially purchased from Fisher Scientific Company (Waltham, MA, USA) with a symmetrical pore size of 0.45 µm and a diameter of 47mm. The tridentate chelator, iminodiacetic acid (IDA), and 50% (w/w) GA were also purchased from Sigma-Aldrich Chemical Company. Bovine serum albumin, sulfuric acid, copper sulfate, silver nitrate, ethylenediaminetetraacetic acid (EDTA), acetic acid, and sodium bicarbonate were purchased from Fisher Scientific Company. All materials were used without further purification.
Thompson A.K., Hackett C., Grady T.L., Enyinnia S., Moore QC I.I.I, & Nave F.M. (2020). Development and Characterization of Membranes with PVA Containing Silver Particles: A Study of the Addition and Stability. Polymers, 12(9), 1937.
+ Open protocol
+ Expand
2

Protein Purification and Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Dimethyl(2-hydroxy-5-nitrobenzyl)sulfonium bromide (HNSB), deuterium oxide, pepsin, imidazole, 3-morpholinopropanesulfonic acid (MOPS), potassium acetate, potassium bromide, urea, zinc sulfate, deuterium oxide, tris(2-carboxyethyl)phosphine (TCEP), and dithiothreitol (DTT) were obtained from Sigma-Aldrich (St. Louis, MO). urea was purchased from Mallinckrodt Chemicals (Phillipsburg, NJ). Trypsin was purchased from Promega (Madison, WI). Tris(hydroxymethyl)-aminomethane (Tris) and tris(hydroxymethyl)aminomethane hydrochloride (Tris-HCl) were purchased from EM Science (Gladstone, NJ). Human β2m that was purified from human urine was purchased from Lee Biosolutions (St. Louis, MO). Ammonium acetate, methanol, acetonitrile, glacial acetic acid, copper sulfate, and nickel sulfate were obtained from Fisher Scientific (Fair Lawn, NJ). Centricon molecular weight cutoff (MWCO) filters were obtained from Millipore (Burlington, MA). Deionized water was prepared from a Millipore (Burlington, MA) Simplicity 185 water purification system.
Borotto N.B., Zhang Z., Dong J., Burant B, & Vachet R.W. (2017). Increased β-Sheet Dynamics and D-E Loop Repositioning are Necessary for Cu(II)-Induced Amyloid Formation by β-2-Microglobulin. Biochemistry, 56(8), 1095-1104.
+ Open protocol
+ Expand
3

Assay Protocol for Oxidative Stress Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Dexamethasone was obtained from Enzo Life Sciences (USA), D-glucose, metformin, urethane, and thiobarbituric acid were purchased from Fluka. Tris, sodium citrate, dithiobisnitrobenzoate, hydrogen peroxide, adrenaline, and trichloroacetic acid were purchased from Sigma-Aldrich, Germany. NaHCO3 and Na2HPO4 were provided by Riedel-de Haën AG. Na2CO3, KH2PO4, NaCl, and orthophosphoric acid were purchased from BDH (Chemicals Ltd., Poole, England). Naphtylethylene diamine and acetic acid were purchased from Merck and sulfanilamide was purchased from Alfa Aesar, sodium nitrite from Analytica Reagent, and copper sulfate from Fisher, while sodium-potassium tartrate, potassium iodine, sodium hydroxide, and potassium dichromate were obtained from Carl Roth (Germany). Cholesterol and triglycerides kits were purchased at IMMESCO (Italy).
Fofié C.K., Nguelefack-Mbuyo E.P., Tsabang N., Kamanyi A, & Nguelefack T.B. (2018). Hypoglycemic Properties of the Aqueous Extract from the Stem Bark of Ceiba pentandra in Dexamethasone-Induced Insulin Resistant Rats. Evidence-based Complementary and Alternative Medicine : eCAM, 2018, 4234981.
+ Open protocol
+ Expand
4

Preparation and Analysis of Environmental Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols
Copper sulfate (CuSO4), ethanol (C2H5OH), potassium ferrocyanide (K4Fe(CN)6), phosphate-buffered saline (PBS) solution, sodium sulfate (Na2SO4), magnesium chloride (MgCl2), aluminum chloride (AlCl3), mercury (II) nitrate hydrate (H2HgN2O7), sodium hydroxide (NaOH), hydrochloric acid (HCl), ammonium nitrate (NH4NO3), humic acid salt, atrazine, glufosinate-ammonium, and chlorpyrifos were obtained from Fisher Scientific (Waltham, MA, USA). Potassium nitrate (KNO3), potassium chloride (KCl), sodium bicarbonate (NaHCO3), calcium chloride (CaCl2), magnesium sulfate (MgSO4), ammonium chloride (NH4Cl) silver/silver chloride paste (Ag/Ag/Cl), glyphosate [N-(phosphonomethyl)glycine], (aminomethyl)phosphonic acid (AMPA), phosphoric acid (H3PO4), and a certified reference material 44,690-U for glyphosate (1000 μg⋅mL−1 solution in distilled water) were purchased from Sigma Aldrich Inc. (St. Louis, MO, USA). Kapton™ (polyimide) film (electrical grade polyimide film, 0.0050″ thick) was obtained from McMaster-Carr (Elmhurst, IL, USA). Calcium sulfate was obtained from Watson (Caruthers, California, USA). Roundup® was bought from a local agricultural store (Bayer Inc., Whippany, NJ, USA).
Bahamon-Pinzon D., Moreira G., Obare S, & Vanegas D. (2022). Development of a nanocopper-decorated laser-scribed sensor for organophosphorus pesticide monitoring in aqueous samples. Mikrochimica Acta, 189(7), 254.
+ Open protocol
+ Expand
5

Antibiotic Susceptibility Profiling of C. difficile

Check if the same lab product or an alternative is used in the 5 most similar protocols
C. difficile 630Δerm and 630Δerm ΔrelQ cultures were prepared by inoculating individual colonies into 3 mL of BHIS broth and grown for 14-16 h at 37 μC in the anaerobic chamber. The overnight cultures were diluted 1:20 into BHIS broth containing the indicated concentrations of fidaxomicin (Cayman Chemical), vancomycin (VWR), metronidazole (VWR), copper sulfate (Fisher Scientific), or diamide (MP Biomedicals) into sterile 96-well plates (Fisher Scientific). The plates were incubated at 37 °C for 24 h in a Stratus microplate reader (Stellar Scientific), which was set to record the optical density at 600 nm every 30 min.
Malik A., Oludiran A., Poudel A., Alvarez O.B., Woodward C, & Purcell E.B. (2024). RelQ-mediated alarmone signaling regulates growth, sporulation, and stress-induced biofilm formation in Clostridioides difficile. bioRxiv.
+ Open protocol
+ Expand
6

Recombinant D7 Protein Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Ae. aegypti total cellular RNA was converted to cDNA using random primers and the Superscript III First-Strand Synthesis System (ThermoFisher). Long form D7 protein (AAEL006424) was amplified using F 5’ GGAGGTACCGATGAAGCTGCCTCTATTACTCGCAATAGTTAC 3’ and R 5’ GGAGCGGCCGCAATTGTGGACACTGTTTACCGTCG 3’ primers and cloned into the pMT/BiP/V5-His A plasmid via BamHI and NotI restriction sites. pMT/BiP/D7/V5-His A and pCoHygro plasmids were transfected into S2 cells using the calcium phosphate method according to manufacturers’ instructions (ThermoFischer) and a stable cell line was generated through hygromycin selection. D7 synthesis and secretion was induced by treating cells with copper sulfate according to manufacturer’s instructions (ThermoFisher). D7 expression was confirmed by Coomassie Blue gel staining and Western blot using an anti-6 His antibody. Supernatants were also harvested from uninduced S2 cell supernatants and used as negative controls.
Conway M.J., Londono-Renteria B., Troupin A., Watson A.M., Klimstra W.B., Fikrig E, & Colpitts T.M. (2016). Aedes aegypti D7 Saliva Protein Inhibits Dengue Virus Infection. PLoS Neglected Tropical Diseases, 10(9), e0004941.
+ Open protocol
+ Expand
7

Comprehensive Protein Quantification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
Bromocresol green, citric acid, Coomassie brilliant blue (CBB) (G-250), copper sulfate, Folin-Ciocalteau (FC) reagent, O-phosphoric acid, sodium carbonate, sodium hydroxide, sodium potassium tartrate, succinic acid, and tri-sodium citrate were purchased from Thermo Fisher Scientific India Pvt. Ltd., India. Bicinchoninic acid and tetrabromophenol blue were purchased from Carbosynth Limited, Compton, Berkshire, UK. Sodium bicarbonate was purchased from NICE Chemicals Pvt. Ltd., India. Ethanol (>99%) was purchased from Changshu Jangyuan Chemical, China. Bovine serum albumin (BSA) – Fraction V, purchased from Himedia Laboratories Pvt. Ltd., India, was used as standard protein throughout the research. Reagent grade triple deionized distilled water was purchased from Marech Pvt. Ltd., Lalitpur, Nepal. Whatman No. 1 filter paper was purchased from Whatman International Ltd, Maidstone, England, and glass microfiber filter was purchased from VWR International, Pennsylvania, USA. Epoch™ microplate spectrophotometer (Biotek instruments, Inc., USA) was used for spectrophotometric determination of proteins in serum and urine samples.
Pokhrel P., Jha S, & Giri B. (2020). Selection of appropriate protein assay method for a paper microfluidics platform. Practical Laboratory Medicine, 21, e00166.
+ Open protocol
+ Expand
8

In Vivo Nucleotide Incorporation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mice were treated with 0.02 CC of 5 mg/mL EdU for 1 hour prior to sacrifice. EdU staining was performed following incubation of slides with secondary antibody. AF-647 azide, copper sulfate and EdU additive buffer and reaction buffers (Life Technology) were added to slides. Slides were incubated for 20 min at room temperature, washed and mounted for imaging.
Baksh S.C., Todorova P.K., Gur-Cohen S., Hurwitz B., Ge Y., Novak J.S., Tierney M.T., Racelis J., Fuchs E, & Finley L.W. (2020). Extracellular serine controls epidermal stem cell fate and tumor initiation. Nature cell biology, 22(7), 779-790.
+ Open protocol
+ Expand
9

In Vivo Nucleotide Incorporation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols
Mice were treated with 0.02 CC of 5 mg/mL EdU for 1 hour prior to sacrifice. EdU staining was performed following incubation of slides with secondary antibody. AF-647 azide, copper sulfate and EdU additive buffer and reaction buffers (Life Technology) were added to slides. Slides were incubated for 20 min at room temperature, washed and mounted for imaging.
Baksh S.C., Todorova P.K., Gur-Cohen S., Hurwitz B., Ge Y., Novak J.S., Tierney M.T., Racelis J., Fuchs E, & Finley L.W. (2020). Extracellular serine controls epidermal stem cell fate and tumor initiation. Nature cell biology, 22(7), 779-790.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!