The ermBL and ermDL DNA templates for toeprinting were generated by a four-primer PCR using AccuPrime DNA Polymerase (Thermo Fisher Scientific) as described previously (25 (link)). Toeprinting reactions were carried out in 5 μl of PURExpress transcription–translation system (New England Biolabs) as previously described (25 (link),26 (link)). The reverse transcription was carried out using primer NV1 (GGTTATAATGAATTTTGCTTATTAAC) (26 (link)). The final concentrations of MTM, PKM and TEL in the reactions were 150 μM; concentration of retapamulin (Sigma-Aldrich) was 50 μM; borrelidine (Santa Cruz Biotech) or L-PSA (kindly provided by Dr Rogelio Cruz-Vera, University of Alabama-Huntigton), the inhibitors or ThrRS or ProRS, respectively, were present in the corresponding reactions at 50 μM.
Retapamulin
Manufactured by Merck Group
Sourced in United Kingdom
Retapamulin is a topical antibiotic compound developed and manufactured by Merck Group. It is a semi-synthetic derivative of the naturally occurring compound pleuromutilin. Retapamulin functions as an inhibitor of bacterial protein synthesis.
Automatically generated - may contain errors
Lab products found in correlation
Pentamidine isethionate, by Merck Group (2 mentions)
Doxycycline hyclate, by Merck Group (2 mentions)
Sb203580, by Cell Signaling Technology (2 mentions)
Mupirocin, by Merck Group (2 mentions)
Tiamulin, by Merck Group (2 mentions)
Accuprime dna polymerase, by Thermo Fisher Scientific (1 mentions)
Purexpress transcription translation system, by New England Biolabs (1 mentions)
Fusidic acid, by Merck Group (1 mentions)
Calf blood, by Thermo Fisher Scientific (1 mentions)
Rifampicin, by Merck Group (1 mentions)
Apramycin, by Merck Group (1 mentions)
Eravacycline, by MedChemExpress (1 mentions)
Streptomycin, by Santa Cruz Biotechnology (1 mentions)
Omadacycline, by MedChemExpress (1 mentions)
Capreomycin, by Merck Group (1 mentions)
Tetracycline, by Merck Group (1 mentions)
Kasugamycin, by Merck Group (1 mentions)
Spectinomycin, by Santa Cruz Biotechnology (1 mentions)
Hygromycin b, by Cayman Chemical (1 mentions)
Gentamicin, by Carl Roth (1 mentions)
7 protocols using retapamulin
1
Toeprinting Assay for Macromolecular Interactions
2
Metabolic Stress Response in Mitochondrial Dysfunction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MELAS cybrid cells and Rieske KO fibroblasts were seeded in 2.5 mM glucose with 22.5 mM galactose media at a density of 1.0×105 cells per well in 6-well plates. ND1 and ND6 mutant cybrid cells were seeded in 25 mM galactose media with 0 mM glucose at a density of 1.0×105 cells per well in 6-well plates. Stocks of doxycycline hyclate (Sigma, D9891), pentamidine isethionate (Sigma, 1504900), and retapamulin (Sigma, CDS023386) were dissolved in DMSO at 100 mM. Compounds were added to wells at the time of seeding at a final concentration indicated in the figures and figure legends (1 nM-100 μM). The p38 inhibitor, SB203580 (Cell Signaling, 5633S) was dissolved in DMSO and used at a final concentration of 25 μM as previously described 33 (link). MELAS and Rieske KO cells were counted after 48 hours incubation, unless otherwise noted. ND1 and ND6 were maintained for the time point indicated in the figure legends with galactose (0 mM glucose) media. For long term survival experiments in low-glucose (e.g. MELAS/Rieske cells) or galactose (e.g. ND1/ND6 cells) media, fresh media and drug were replaced every 24 or 48 hours.
3
Cultivation and Characterization of MRSA Strains
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The clinical strains MRSA 43484 and 88779 were isolated from patients with skin abscesses and were obtained from UNION therapeutics A/S. The laboratory strains of S. aureus used in this study (ATCC 29213, ATCC 25293, NCTC 8325, and JE2) were obtained from the Department of Veterinary Disease Biology at the University of Copenhagen. S. aureus RN4220 and its mutator derivative RN4220 ΔmutS were kindly provided by A. J. O'Neill (University of Leeds, UK).
All strains were cryopreserved in Brain Heart Infusion broth supplemented with glycerol 15% (v/v) at −80°C and cultivated aerobically at 37°C in nutrient agar base no. 2 supplemented with calf blood 5% (v/v) (Oxoid, Basingstoke, UK). All bacterial cultures were grown in Mueller–Hinton broth (MHB) (Oxoid, Basingstoke, UK). When appropriate, culture medium was supplemented with ATx201 (Niclosamide; CAS: 50‐65‐7), rifampicin, fusidic acid, mupirocin, and retapamulin (Sigma‐Aldrich) and the pH adjusted to different values with NaOH and HCl solutions of different concentrations (.1, 1, 2 and 5 M).
All strains were cryopreserved in Brain Heart Infusion broth supplemented with glycerol 15% (v/v) at −80°C and cultivated aerobically at 37°C in nutrient agar base no. 2 supplemented with calf blood 5% (v/v) (Oxoid, Basingstoke, UK). All bacterial cultures were grown in Mueller–Hinton broth (MHB) (Oxoid, Basingstoke, UK). When appropriate, culture medium was supplemented with ATx201 (Niclosamide; CAS: 50‐65‐7), rifampicin, fusidic acid, mupirocin, and retapamulin (Sigma‐Aldrich) and the pH adjusted to different values with NaOH and HCl solutions of different concentrations (.1, 1, 2 and 5 M).
4
Reconstitution of E. coli 70S Ribosomes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In vitro reconstituted E. coli 70S ribosomes were generated from the E. coli K12 strain BW25113, as described previously56 (link). Antibiotic–ribosome samples were generated by incubating antibiotic cocktails 1–5 with E. coli 70S ribosomes in buffer A (50 mM HEPES-KOH, pH 7.5, 25 mM Mg(OAc)2, 80 mM NH4Cl, 100 mM KOAc, 1 mM DTT, 0.05% DDM) at 37 °C for 15 min, before being frozen at −80 °C until use. Final antibiotic concentrations for complexes formed with each cocktail was: cocktail 1 contained 200 μM omadacycline (MedChemExpress), 200 μM spectinomycin (Santa Cruz Biotechnology), 200 μM streptomycin (Santa Cruz Biotechnology), 200 μM evernimicin, 200 μM hygromycin B (Cayman Chemical); cocktail 2 contained 100 μM capreomycin (Sigma Aldrich), 100 μM kasugamycin (Sigma Aldrich) and 100 μM retapamulin (Sigma Aldrich); cocktail 3 contained 100 μM tetracycline (Sigma Aldrich), 100 μM viomycin (Sigma Aldrich), 100 μM streptomycin (Santa Cruz Biotechnology), 100 μM lincomyin (Sigma Aldrich) and 100 μM avilamycin (Cayman Chemical); cocktail 4 contained 10 μM apramycin (Sigma Aldrich), 10 μM eravacycline (MedChemExpress) and 100 μM clindamycin (Santa Cruz Biotechnology); cocktail 5 contained 100 μM pentacycline (Tetraphase), 10 μM gentamicin (Carl Roth) and 100 μM tiamulin (Sigma Aldrich).
5
Antimicrobial Agents Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Ertapenem, polymyxin B, mupirocin, retapamulin and chloramphenicol (Sigma-Aldrich, UK) were prepared as 10 mg/ml stock solutions as directed.
6
Metabolic Stress Response in Mitochondrial Dysfunction
7
Screening for Pleuromutilins Resistance in Non-aureus Staphylococci
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The collection of non-aureus staphylococci used in this study (n = 363) comprised 214 human isolates recovered from hospitals in the UK, Canada and Italy between 2012 and 2016 and 149 veterinary isolates obtained from the Royal Veterinary College (London, UK). Bacteria were routinely cultured at 37°C using cation-adjusted Mueller Hinton agar (MHA) or broth (MHB) (Sigma-Aldrich) for 18–24 h. To detect PLM resistance, bacteria (104 CFU) were spotted onto MHA containing retapamulin (AdooQ BioScience) at 2 μg/ml (20 (link)). Strains that grew on these plates were subjected to susceptibility determinations with retapamulin and other PLMs (tiamulin [Sigma-Aldrich] and lefamulin [DC Chemicals]) by broth microdilution according to CLSI methodology (21 ). PCR amplification and DNA sequencing of the 16S rDNA (22 (link)) or the rpoB gene (23 (link)) were employed for species identification of resistant isolates.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!