Mirna first strand cdna synthesis kit

Manufactured by Tiangen Biotech

Sourced in China

The MiRNA First-Strand cDNA Synthesis Kit is a laboratory tool designed for the reverse transcription of microRNA (miRNA) into complementary DNA (cDNA) for downstream applications. The kit provides the necessary reagents and protocols to efficiently convert miRNA into cDNA, which can then be used in various analyses, such as real-time PCR or other molecular techniques.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (3 mentions) Mirna extraction kit, by Tiangen Biotech (2 mentions) Mirna isolation kit, by Tiangen Biotech (2 mentions) Trizol reagent, by Beyotime (2 mentions) Mircute mirna isolation kit, by Tiangen Biotech (2 mentions) Mirna qpcr detection kit sybr green, by Tiangen Biotech (2 mentions) Abi quantstudio 3 system, by Thermo Fisher Scientific (2 mentions) Mircute plus mirna qpcr detection kit, by Tiangen Biotech (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Superreal premix plus sybr green kit, by Tiangen Biotech (2 mentions) Triquick reagent, by Solarbio (2 mentions) Superscript 3 first strand synthesis system, by Thermo Fisher Scientific (2 mentions) Mirna qpcr kit, by Tiangen Biotech (1 mentions) Cfx96, by Bio-Rad (1 mentions) Total rna extraction kit, by Takara Bio (1 mentions) Reverse transcription pcr kit, by Takara Bio (1 mentions) Random primer reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Sybr green kit, by Takara Bio (1 mentions) Beyort 2 first strand cdna synthesis kit, by Beyotime (1 mentions) Trizol reagent, by Solarbio (1 mentions)

Close spelling variants of this product

CDNA synthesis kit (50 citations) MiRNA cDNA synthesis kit (3 citations)

26 protocols using mirna first strand cdna synthesis kit

miRNA Isolation and Quantification in hASMCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the isolation of RNA from hASMCs, the miRNA extraction isolation kit (DP501) provided by TIANGEN (China) was utilized. To synthesize cDNA, we used miRNA cDNA first-strand synthesis kit (KR211) bought from TIANGEN (China). Then, qRT-PCR was carried out utilizing a miRNA qPCR kit (FP411, TIANGEN, China) in a PCR system (CFX96, Bio-Rad, USA). Gene-specific primers were as follows: miR-155 forward: 5′‐GGCTAAGGAGATTGGTGCTGTA-3′, Reverse: 5′‐ACGAGGGGCTG-AGACATTTAC-3′; U6 forward: 5′‐AGTAAGCCCTTGCTGTCAGTG-3′, Reverse: 5′‐CCTGGGTCTGATAATGCTGGG-3′.
U6 was validated as the normalizer. The 2^−ΔΔCt was employed for data evaluation.

Dong L., Li H., Li M., Zhang L., Qiu C, & Chen Y. (2022). Wenshen Yiqi Keli Mitigates the Proliferation and Migration of Cigarette Smoke Extract-Induced Human Airway Smooth Muscle Cells through miR-155/FoxO3a Axis. Evidence-based Complementary and Alternative Medicine : eCAM, 2022, 4427637.

+ Open protocol

+ Expand

Quantifying FOXO1 and miR-31-3p Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were collected to extract total mRNA by Total RNA Extraction Kit (TaKaRa, Japan) and extract miRNA using miRNA Extraction Kit (Tiangen, China), and then, they were stored at -80°C. Then, mRNA was reverse-transcribed to synthesize cDNA relying on the instructions of reverse transcription PCR kit (TaKaRa, Japan), and miRNA was conformed to the instructions of the miRNA cDNA first-strand synthesis kit (Tiangen, China) to synthesize cDNA, with the concentration and purity of the synthesized cDNA tested. The cDNA was used to detect the expression of FOXO1 and miR-31-3p based on the instructions of the real-time PCR and miRNA fluorescence quantitative detection kit, and the 2^−ΔΔCt method was used for data analysis. The primer sequences are shown in Table 1.

Zeng X., Liu D., Peng G., Liu J, & Yang H. (2022). MiroRNA-31-3p Promotes the Invasion and Metastasis of Non-Small-Cell Lung Cancer Cells by Targeting Forkhead Box 1 (FOXO1). Computational and Mathematical Methods in Medicine, 2022, 4597087.

+ Open protocol

+ Expand

Quantitative Analysis of TCF3, HDAC3, and miR-101 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The TRizol method was used to extract total RNA from tissues and cells, and a miRNA extraction and isolation kit (Tiangen, China) was used to extract miRNA. After detecting the concentration and purity of RNA, Random Primer Reverse Transcription Kit (Thermo, USA) was used to reversely transfer the mRNA to cDNA, and the miRNA cDNA first-strand synthesis kit (Tiangen, China) was used to synthesize the miRNA cDNA. The expression levels of TCF3, HDAC3, and miR-101 were detected following the instruction of the SYBR GREEN kit (TaKaRa, Japan). GAPDH and U6 were chosen as internal control controls, and the experiment set 6 replicates. The experimental data were dealt with the 2^−ΔΔCt method to calculate the relative expression of target genes. The primer sequences are in Table 1.

Table 1.

Primer sequence

RNA	Sequences(5ʹ- to 3ʹ-)
TCF3	F: 5ʹ- CCAGACCAAACTGCTCATCCTG
TCF3	R: 5ʹ- TCGCCGTTTCAAACAGGCTGCT
miR-101	F: 5ʹ- GGGTGGCCATTGCTAATGCT
miR-101	R: 5ʹ-GCACTCAGGGTAGGTCAT
HDAC3	F: 5ʹ- GAGTTCTGCTCGCGTTACACAG
HDAC3	R: 5ʹ- CGTTGACATAGCAGAAGCCAGAG
U6	F: 5ʹ- CTCGCTTCGGCAGCACAT
U6	R: 5ʹ- TTTGCGTGTCATCCTTGCG
GAPDH	F 5ʹ-CGGAGTCAACGGATTTGGTCGTAT-3’
GAPDH	R 5ʹ-AGCCTTCTCCATGGTGGTGAAGAC-3’

Dong L., Huang J., Zu P., Liu J., Gao X., Du J, & Li Y. (2021). Transcription factor 3 (TCF3) combined with histone deacetylase 3 (HDAC3) down-regulates microRNA-101 to promote Burkitt lymphoma cell proliferation and inhibit apoptosis. Bioengineered, 12(1), 7995-8005.

+ Open protocol

+ Expand

Quantify miRNA Expression in NSCLC

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from serum and EBC using the miRNA extraction kit
(Tiangen DP503, China) in accordance with the manufacturer’s protocol. Then,
total RNA containing miRNA was reverse transcribed to cDNA by using the miRNA
cDNA first strand synthesis kit (Tiangen KR211, China). The qRT-PCR was
performed on a StepOnePlus real-time PCR instrument by using the SYBR Green I
fluorescent dye method. miR-39 was selected as the external reference gene
because of its stable presence in the serum according to previous studies.^{26 (link)} Three replicate wells were provided for each sample. The relative
expression of miR-186 was calculated by using the 2^-ΔΔCt method,
where ΔΔCt = NSCLC (Ct target gene − Ct reference gene) − healthy controls (Ct
target gene − Ct reference gene).

Xie H., Chen J., Lv X., Zhang L., Wu J., Ge X., Yang Q., Zhang D, & Chen J. (2020). Clinical Value of Serum and Exhaled Breath Condensate miR-186 and IL-1β Levels in Non-Small Cell Lung Cancer. Technology in Cancer Research & Treatment, 19, 1533033820947490.

+ Open protocol

+ Expand

Profiling miRNA Expression in Vascular Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted and purified from 1 cm-thick vascular tissues (Ambition, Carlsbad, USA) by using a Trizol reagent homogeniser. MiRNAs were extracted using miRcute miRNA extraction and separation kits following the manufacturers’ protocols (DP501, Tiangen Biotech). Total RNA was reverse transcribed into cDNA using a miRcute-enhanced miRNA cDNA first-strand synthesis kit (KR211-02, Tiangen Biotech). RT-PCR analysis was performed using a miRcute-enhanced miRNA quantitative fluorescence kit and SYBR qPCR Mix (Monad, Wuhan, China). The primers used for qPCR are presented in Table 1. mRNA expression levels were quantified using the 2^−∆∆Cq method and normalised to the internal reference gene β-actin or U6.Table 1

Primer sequences for qPCR

Gene	Forward primer (5′-3′)	Reverse prime (5′-3′)	Product size	Gene bank accession number
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT	50 bp	NR_138085.1
miR-92a-3p	ATAACGTGAACAGGGCCG	CAGTGCGTGTCGTGGAGT	50 bp	NR_032335.1
β-actin	CGTAAAGACCTCTATGCCAACA	TAGGAGCCAGGGCAGTAATC	100 bp	NM_031144.3
HO-1	CAGAAGAGGCTAAGACCGCC	GGGGCCAACACTGCATTTAC	288 bp	NM_012580.2

Wen C., Ying Y., Zhao H., Jiang Q., Gan X., Wei Y., Wei J, & Huang X. (2021). Resistance exercise affects catheter-related thrombosis in rats through miR-92a-3p, oxidative stress and the MAPK/NF-κB pathway. BMC Cardiovascular Disorders, 21, 440.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs from colon tissues and RAW264.7 cells were isolated using the TRIzol reagent (R1100, Solarbio). Subsequently, cDNAs were synthesized using the BeyoRT™ II cDNA first‐strand synthesis kit (D7168S, Beyotime) or miRNA cDNA first‐strand synthesis kit (KR211, TIANGEN). Then, we used the 2×Taqman PCR MasterMix (SR2110, Solarbio) and PCR instrument (CFX96, Bio‐Rad) to generate qRT‐PCR reactions. The results were normalized to GAPDH or U6, and the 2^−ΔΔC^t method was utilized to count the mRNA expression levels.²⁷ Primers are shown in Table 1.

Shi L., Zhang P., Jin R., Chen X., Dong L, & Chen W. (2022). Dioscin ameliorates inflammatory bowel disease by up‐regulating miR‐125a‐5p to regulate macrophage polarization. Journal of Clinical Laboratory Analysis, 36(6), e24455.

+ Open protocol

+ Expand

Serum miRNA Profiling by qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Serum total RNA was isolated using the miRcute serum/plasma miRNA isolation kit (TianGen, Beijing, China) and reverse transcribed using a miRNA First‐Strand cDNA Synthesis kit (TianGen) according to the manufacturer's instructions. Because of the the lack of a stable endogenous serum miRNA, samples were spiked with a synthetic Caenorhabditis elegans mir‐39 miRNA mimic (cel‐mir‐39) as a control to monitor changes in RNA recovery. The real‐time qPCR was performed in a Roche LightCycler480II using the miRcute miRNA Detection Kit (TianGen). Relative expression of target miRNAs was calculated using the comparative 2^‐ΔΔCt method with external control. In virtue of the lack of a stable endogenous serum miRNA, samples were spiked with a synthetic C. elegans mir‐39 miRNA mimic (cel‐mir‐39) as a control to monitor changes in RNA recovery. cel‐mir‐39 was the external control. Primers for miR‐26a, miR‐30b, miR‐30c, miR99a, miR100, miR181a, and the external control were designed by the authors. Primer sequences of these miRs as follows:miR‐30b‐5p: 5'‐GCGTCCTGTAAACATCCTACACTCAGCT‐3'miR‐99a‐5p: 5'‐GCGTAACCCGTAGATCCGATCTTGTG‐3'miR‐100‐5p: 5'‐GCGTAACCCGTAGATCCGAACTTGTG‐3'miR‐181a‐5p: 5'‐GCGTCCAACATTCAACGCTGTCGGTGAGT‐3' The universal reverse primer and primers for miR‐26a and miR‐30c were purchased from TianGen (Beijing, China).

Cai Y., Zhang H., Fan C., Zeng Y., Zou S., Wu C., Wang L., Fang S., Li P., Xue Y, & Guan M. (2019). Renoprotective effects of brown adipose tissue activation in diabetic mice. Journal of Diabetes, 11(12), 958-970.

+ Open protocol

+ Expand

Comprehensive RNA Extraction and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using an RNA extraction kit (Tiangen Biotech, Beijing, China). For mRNA detection, the SuperScript IV reverse transcriptase system (Thermo Fisher Scientific, Carlsbad, CA, USA) was used for cDNA synthesis. PCR reactions were performed using the SYBR® Premix Ex Taq™ (Takara, Dalian, China). For miRNA detection, RNA was reverse transcribed into cDNA by using the miRNA First-Strand cDNA synthesis kit (Tiangen). PCR was conducted using the miRNA qPCR detection kit (Tiangen). Data were processed with the 2^−ΔΔCt method after normalizing to GAPDH or U6. Primer sequences are given in Additional file 1: Table S2.

Hu Q., Tian T., Leng Y., Tang Y., Chen S., Lv Y., Liang J., Liu Y., Liu T., Shen L, & Dong X. (2022). The O-glycosylating enzyme GALNT2 acts as an oncogenic driver in non-small cell lung cancer. Cellular & Molecular Biology Letters, 27, 71.

+ Open protocol

+ Expand

Analyzing microRNA and mRNA Expression in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols

One-cell stage zebrafish embryos were injected with a solution consisting of 30 ng/μl CMV-Gal4-VP16 plasmid and 30 ng/μl pUAS-mCherry/pUAS-mCherry-mircoRNA/pUAS-mCherry-miR-shRNA. To detect miRNAs level, 3 days post fertilization (dpf) zebrafish larvae with relatively high mosaic red fluorescence were selected for total RNAs isolation by miRNA Isolation Kit (Tiangen), according to the manufacturer's protocols. Each sample was reverse-transcribed into cDNA by miRNA First-Strand cDNA Synthesis Kit (Tiangen) and was subjected to qRT-PCR analysis with qPCR Detection Kit (Tiangen). To detect mRNAs levels, 10 hpf zebrafish embryos expressing red fluorescence were selected to isolate total RNAs with the same kit mentioned above. Each sample was reverse-transcribed into cDNA with HiScriptII Q RT SuperMix (Vazyme) and was subjected to qRT-PCR analysis with AceQ qPCR SYBR Master Mix (Vazyme). Each experiment was carried out with three biological and experimental replicate. Results were shown as mean fold changes ±s.e.m. qRT–PCR primers were shown in Table S1.

Huang R., Chen M., Yang L., Wagle M., Guo S, & Hu B. (2017). MicroRNA-133b Negatively Regulates Zebrafish Single Mauthner-Cell Axon Regeneration through Targeting tppp3 in Vivo. Frontiers in Molecular Neuroscience, 10, 375.

+ Open protocol

+ Expand

Profiling Circular RNA and miRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Utilizing TRIzol Reagent (Beyotime), total RNA was isolated and then identified by a micro-spectrophotometer (Thermo Fisher, Waltham, MA, USA). RNA was assembled into cDNA using SuperScript™ III First-Strand Synthesis System (Thermo Fisher) or using miRNA First Strand cDNA Synthesis Kit (TianGen, Beijing, China), followed by qPCR using SYBR GreenER™ qPCR SuperMix (Invitrogen). Internal references used here were GAPDH and U6. The 2^−△△Ct method was employed to calculate relative expression. The sequences of primers were listed in Table 1.Table 1

Primers sequences used for qPCR

Name		Primer sequence (5′–3′)
circTBX5(hsa_circ_0003176)	Forward	AATGTCAAGAATGCAAAGAGCAG
circTBX5(hsa_circ_0003176)	Reverse	CTTTGATTCCCTCCATGCCCT
MyD88	Forward	GCATATGCCTGAGCGTTTCG
MyD88	Reverse	GTGGCCTTCTAGCCAACCTC
miR-146b-3p	Forward	GATTAGGCCCTGTGGACTCA
miR-146b-3p	Reverse	CTCAACTGGTGTCGTGGAGTC
miR-558	Forward	CTCCGAGTGAGCTGCTGTAC
miR-558	Reverse	TCAACTGGTGTCGTGGAGTC
miR-637	Forward	TTTAGACTGGGGGCTTTCGGG
miR-637	Reverse	CTCAACTGGTGTCGTGGAGTCG
miR-645	Forward	GATTCCGAGTCTAGGCTGGTAC
miR-645	Reverse	TCAACTGGTGTCGTGGAGTC
GAPDH	Forward	CAAATTCCATGGCACCGTCA
GAPDH	Reverse	GACTCCACGACGTACTCAGC
U6	Forward	CTTCGGCAGCACATATACT
U6	Reverse	AAAATATGGAACGCTTCACG

Wei W., Mu H., Cui Q., Yu P., Liu T., Wang T, & Sheng L. (2023). CircTBX5 knockdown modulates the miR-558/MyD88 axis to alleviate IL-1β-induced inflammation, apoptosis and extracellular matrix degradation in chondrocytes via inactivating the NF-κB signaling. Journal of Orthopaedic Surgery and Research, 18, 477.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!