T4 kinase

The hap gene and its upstream 500 bp region, was amplified by PCR with Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific) using NTHi375 genomic DNA as template, and primers hap-F1 (5´-ACTATCGTCGTCATTGAACACAATCTTGAT)/hap-R1 (5´-TTAAGCGTAGTCTGGGACGTCGTATGGGTACCAACGATACCCCAATTTCACGCCCAC). The hap-R1 reverse primer was used to introduce an HA tag coding sequence at the 3´end of the hap gene. This 4,677 bp blunt PCR product was phosphorylated with T4 kinase (New England Biolabs), and cloned into pSU20 [32 (link)], previously digested with HincII and dephosphorylated with antarctic phosphatase (New England Biolabs), generating pSU20-Pr::hap_NTHi375-HA. pSU20 and pSU20-Pr::hap_NTHi375-HA were transformed into electrocompetent Hi RdKW20. Transformations were selected on sBHI-agar with Cm₁. Hi RdKW20, RdKW20 (pSU20) and RdKW20 (pSU20-Pr::hap_NTHi375-HA) whole cell extracts were prepared from cultures grown to OD₆₀₀ = 0.9 in sBHI containing Cm₁, when required. Hap_NTHi375-HA expression was analyzed by western blot with a primary rabbit anti-HA antibody (Sigma) diluted 1:4000, and a secondary goat anti-rabbit IgG (whole molecule, Sigma) antibody conjugated to horseradish peroxidase, diluted 1:1000.

Highly purified p53 was incubated with a ³²p-labelled probe (190 base pairs) containing p53-binding element of ELOVL3 promoter or mutant ELOVL3 promoter in 1× binding buffer (10 mM Hepes, pH 7.6, 40 mM NaCl, 50 µM EDTA, 6.25% Glycerol, 1 mM MgCl₂, 1 mM Spermidine, 1 mM DTT, 50 ng/µl BSA, 5 ng/µl sheared single strand salmon DNA) for 20 minutes at room temperature (RT). The complex was analyzed by 4% TBE-PAGE and visualized by autoradiography. The probe was obtained by PCR, labelled by T4 kinase (NEB, M0201S) and purified by Bio-Spin column (Bio-Rad, 732-6223).

XPA, XPC, hOGG1/2, p53, and p63 antibodies were purchased from Santa Cruz Biotechnology (Dallas, TX), α-tubulin from Calbiochem (Billerica, MA), IgG antibodies from Amersham Biosciences (Pittsburgh, PA), T4 kinase, protease K, and RNase A from New England Biolabs (Ipswich, MA), α-³²P-dATP from Perkin Elmer (Waltham, MA), and growth medium MEM and EMEM from Sigma and ATCC, respectively. Plasmids were prepared, as described (Wang et al., 2013 (link)).

Nuclear lysates were prepared as described by Jianping Ye (Pennington Biomedical Research Center, Louisiana State University). Oligonucleotides for m18RE and Sp1 consensus sites can be found in Table 3. Oligonucleotides were labeled with ³²P-y-ATP using T4 kinase (NEB). Probes were purified on a G-50 column (G&E health care, Little Chalfont UK), and incorporated radioactivity was measured using a Beckman LS60001C scintillation counter. 4000cpm of labeled probe were added to nuclear lysates. Where indicated, competing unlabeled DNA probes were included in the reaction at a 1000:1 ratio. For super-shift assay 1ug of indicated Ab was added. Samples were run on a 5% native acrylamide gel. Gels were dried before being exposed in phosphofluor cassettes and analyzed using a Typhoon imager.10.7554/eLife.14749.019Table 3.

EMSA Oligos.

DOI:http://dx.doi.org/10.7554/eLife.14749.019

Primer pair	Forward
m18RE	ggctcgcaggtccacgccccttggcaccggag
m18RE*	ggctcgcaggtccaaaccccttggcaccggag
Sp Consensus	attcgatcggggcggggcgagc
Sp* Consensus	attcgatcggttcggggcgagc

DNA fragments that represent the promoter regions of the genes that were differentially regulated in the presence or absence of RamA or RamR were subjected to the electrophoretic gel shift mobility assay (EMSA) as described previously [54 (link)]. Briefly, DNA templates ranging from 250–150bp upstream of the start site were produced by PCR, and purified by StrataPrep PCR Purification kits (Agilent UK). The purified templates were end-labelled with [γ³²P]-ATP by T4 Kinase (New England Biolabs, USA). The unincorporated, labelled ATP was removed using Biospin P6 spin columns (Biorad, UK) as per manufacturer’s instructions. Purified RamA was extracted from the recombinant pETramA construct using metal chelation chromatography on superflow nickel / nitrilotriacetate agarose (Qiagen, Germany) (James Hastie, Dundee University). His-tagged RamA (200 nM) and labelled DNA (2 nM) were mixed in binding buffer (125 mM Tris-HCl, 250 mM KCl, 5 mM DTT 5% glycerol) and incubated on ice for 15 min prior to electrophoresis at 75 V on a prechilled 7.5% native polyacrylamide gel in 1 × TBE buffer.

To generate the heteroduplex substrates we first labelled the top strand with [γ-³²P]dATP (Perkin Elmer) and T4 kinase (New England Biolabs). For the annealing reaction, the labelled oligonucleotide was mixed with the corresponding complementary strand and boiled for 5 min in a 1l beaker, then the water was left to cool down to <30°C. All labelled substrates were purified using illustra Microspin G50 columns (GE Healthcare).
EMSAs were performed as described in [58 (link)]. Briefly, 30 fmol of labelled DNA substrate was incubated with protein in a 20μl reaction containing 10mM Hepes-KOH (pH 7.5), 10 mM KCl, 3.3 mM MgCl2, 1 mM EDTA, 2.5 mM DTT, and 400 ng poly(dI-dC) (Sigma). For His-Rep68, 100 ng of protein was used and the reaction was set up using 15 mM NaCl. For the His-TrwC/Rep chimeric protein, the best conditions were 200 ng of protein and 75 mM NaCl. Cold competitor at 10 to 90-fold excess was added to the reactions where appropriate. After incubation for 20 min at room temperature, samples were spun down and 3 μl of loading buffer (0.25X TBE, 40% sucrose, 1% bromopheonol blue, 1% xylene cyanol) was added. The reactions were analysed on a native 6% polyacrylamide gel in 0.25X TBE. After the run, gels were treated as for the DNA helicase assay.

In 4 μl reactions, total RNA (0.5–1 μg), 2 μl of the RNA co-purified with RNAP or in vitro synthesized RNA (0.2 μg) were 3′ end labeled with 0.2 μl [5′-³²P]-PcP (3000 Ci/mmol; Hartmann), 0.4 μl 10× T4 RNA ligase buffer, 0.4 μl DMSO, 0.3 μl T4 RNA ligase (NEB, Fermentas) and 0.2 μl Superasin for 1–1.5 h at 37°C. Likewise, the 5′ ends of RNAs were labeled with T4 kinase (NEB), 10× T4 kinase buffer and [у-³²P]-ATP (6000 Ci/mmol; Hartmann) in the presence of Superasin. Labeled RNAs were separated on 10% polyacrylamide with 8M urea in TBE and fixed with 50% methanol, 10% acetic acid. Dried gels were exposed to a phosphor-imaging plate and analyzed using ImageQuant software.