Takara taq dna polymerase

PCR amplification and sequencing was performed at the Australian Genome Research Facility (AGRF, Sydney, NSW, Australia). Amplicons for both 16S and ITS were generated using the primers and conditions outlined in Table 1. Thermocycling was completed with an Applied Biosystem 384 Veriti and using AmpliTaq Gold 360 (Life Technologies, Australia). Illumina indexing of the amplicons was achieved in a second PCR utilizing TaKaRa Taq DNA Polymerase (Clontech). Indexed amplicon libraries were quantified by fluorometry (Promega Quantifluor) and normalized. An equimolar pool was created and adjusted to 5 nM for sequencing on an Illumina MiSeq (San Diego, CA, United States) with a V3, 600 cycle kit (2 × 300 base pair, paired-end reads).

Fragments were amplified with the universal fungal primers, ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) (White, Bruns, Lee, & Taylor, 1990) targeting the ITS1 region of the rRNA gene. PCR amplicons were generated using AmpliTaq Gold 360 Master Mix (ThermoFisher Scientific, North Ryde, NSW, Australia) for the primary PCR with the following amplification protocol: 7 min initial denaturing at 95°C, followed by 35 cycles of 30 s at 94°C, 45 s annealing at 55°C, 60 s at 72°C and 7 min final extension at 72°C. A secondary PCR to index the amplicons was performed with TaKaRa Taq DNA Polymerase (Clontech Laboratories).

Polymerase chain reaction (PCR) and sequencing were performed by the Australian Genome Research Facility. PCR amplicons were generated using the primers 341F (5′ CCTAYGGGRBGCASCAG 3′) and 806R (5′ GGACTACNNGGGTATCTAAT 3′) (Yu et al., 2005 (link)). Thermocycling was completed with an Applied Biosystem 384 Veriti and using AmpliTaq Gold 360 master mix (Life Technologies, Australia) for the primary PCR. The first stage PCR was cleaned using magnetic beads, and samples were visualized on 2% Sybr Egel (Thermo-Fisher). A secondary PCR to index the amplicons was performed with TaKaRa Taq DNA Polymerase (Clontech). The resulting amplicons were cleaned again using magnetic beads, quantified by fluorometry (Promega Quantifluor) and normalized. The equimolar pool was cleaned a final time using magnetic beads to concentrate the pool and then measured using a High-Sensitivity D1000 Tape on an Agilent 2200 TapeStation. The pool was diluted to 5 nM and molarity was confirmed again using a High-Sensitivity D1000 Tape. This was followed by sequencing on an Illumina MiSeq instrument with a V3 (600 cycles) kit (Illumina).

DNA was extracted from pharyngeal swab samples using the QIAamp DNA Microbiome Kit (QIAGEN, cat#51704) following the manufacturer’s guidelines. PCR amplification and sequencing were performed by the Australian Genome Research Facility (AGRF). Briefly, universal 16S ribosomal RNA (rRNA) gene primers were used to amplify the V3–V4 region of the bacterial 16S rRNA gene of each sample, using AmpliTaq Gold 360 mastermix (Life Technologies, Australia) for the primary PCR. A secondary PCR to index the amplicons was performed with TaKaRa Taq DNA Polymerase (Clontech). The cycling conditions consisted of 95 °C for 7 min; 29 cycles of 94 °C for 30 s, 50 °C for 60 s, and 72 °C for 60 s; and then final extension at 72 °C for 7 min. The resulting amplicons were quantified using the fluorescent PicoGren assay and measured by fluorometry (Invitrogen Picogreen) and normalised. The eqimolar pool was then measured by qPCR (KAPA) followed by sequencing on the Illumina MiSeq (San Diego, CA, USA) with 2 × 300 base pairs paired-end chemistry. Negative (HPLC water) and positive (the BEI 16S gDNA mock community 782D) controls, as well as all samples, were sequenced on the same batch.

Fecal samples, collected on day 20, from three pigs in each group were sequenced for diversity profiling to compare the microbiome between the two groups. Polymerase chain reaction (PCR) amplification and sequencing were performed by the Australian Genome Research Facility (Melbourne, VIC). PCR amplicons were generated using the 341F and 806R primers to amplify the V3-V4 region of the 16S gene. Thermocycling was completed with an Applied Biosystem 384 Veriti and using Platinum SuperFi mastermix (Life Technologies, Australia) for the primary PCR. The first stage PCR was cleaned using magnetic beads, and samples were visualized on 2% Sybr Egel (Thermo-Fisher). A secondary PCR to index the amplicons was performed with TaKaRa Taq DNA Polymerase (Clontech). The resulting amplicons were cleaned again using magnetic beads, quantified by fluorometry (Promega Quantifluor) and normalized. The eqimolar pool was cleaned a final time using magnetic beads to concentrate the pool and then measured using a High-Sensitivity D1000 Tape on an Agilent 2200 TapeStation. The pool was diluted to 5 nM and molarity was confirmed again using a High-Sensitivity D1000 Tape. This was followed by sequencing on an Illumina MiSeq (San Diego, CA, USA) with a V3, 600 cycle kit (2 × 300 base pairs paired-end).

For qPCR template, 8 ng of cDNA (0.125 ng for quantification of 25S cDNA) was used as in a reaction containing: 1× Platinum Taq PCR Buffer (200 mM Tris-HCl, pH 8.4, 500 mM KCl) (Life Technologies), 2.5 mM MgCl₂, 0.2 mM dNTPs, 1× ROX Reference Dye (Life Technologies), 1× SYBR Green I (Life Technologies), 500 nM each primer and 5 U/µl Platinum Taq DNA Polymerase (Life Technologies), or 5 U/µl TaKaRaTaq DNA Polymerase (Clontech, Mountain View, CA) in a 20-μl reaction with filtered sterile DEPC-treated water. Amplification was as follows: 50° for 2 min, 95° for 10 min followed by 40 cycles at 95° for 15 sec, and 60° for 1 min; 25S rRNA was used as an internal control for normalization.