Nucleospin plasmid mini kit

All sequences were codon optimized for E. coli and synthesized as a DNA fragment by Twist Bioscience. The genes were cloned blunt end into pJET2.1 vectors using the New England Biolabs kit. After sequencing, genes were cloned into the pET16 bp vector by means of the Gibson assembly (50 (link)). Primers are listed in Table S4. The success of the PCR was controlled by agarose gel electrophoresis. The Gibson assembly mix was digested with DpnI for 1.5 h at 37 °C before being transformed in competent E. coli DH5a cells, which were plated on LB agar containing 100 μg ml⁻¹ ampicillin. Clones were picked the next day and grown in a 5 ml LB medium (10 g l⁻¹ tryptone, 10 g l⁻¹ NaCl, 5 g l⁻¹ yeast extract, 100 μg ml⁻¹ ampicillin) overnight. Plasmids were isolated by the use of Macherey-Nagel NucleoSpin Plasmid Mini Kit, and the success of cloning was validated by sequencing.

Plasmids were constructed in NEB Stable E. coli using restriction cloning, Q5 polymerase, and HiFi Assembly (New England Biolabs, Frankfurt am Main, Germany), according to the manufacturer’s instructions. S. cerevisiae BY 4741 was transformed as in Gietz, et al. [44 (link)]. The details of the constructions are provided in the Supplementary material. Plasmid DNA was isolated with NucleoSpin Plasmid Mini Kit and extracted from an agarose gel with NucleoSpin Gel and PCR Clean up Kit (Macherey-Nagel, Duren, Germany). All constructs were verified by restriction digest and Sanger sequencing. The results of the plasmid analyses agreed with computed restriction maps. Primer synthesis was outsourced to Macrogen Europe (Amsterdam, Netherlands), de novo gene synthesis to Genewiz (Leipzig, Germany), and Sanger sequencing to Microsynth (Balgach, Switzerland).

Plasmid isolation used the NucleoSpin Plasmid Mini Kit (Macherey-Nagel) according to the manufacturer’s protocol. To test for the presence of a complete p100ptaHalo plasmid, the resulting plasmid preparation from each tested sample was transformed into chemically competent NEB 5-alpha Escherichia coli cells per the standard transformation protocol. Following transformation, E. coli cells were incubated at 37°C for 1 h, after which 150 µL of each transformation was plated on LB plates supplemented with 100 µg of ampicillin (p100ptaHalo plasmid contained Amp^R marker for E. coli transformation). The LB plates were incubated at 37°C for 24 h to allow E. coli colonies to develop. Plasmid preparations from cultures initiated from colonies from PtP1.5 and PtP2.5 produced E. coli colonies, indicating that the complete plasmid DNA was present in those samples. Plasmid preparations from cultures initiated from PtP4.5 colonies did not produce any colonies, indicating the complete plasmid was not present in these cells.

FirstChoice RLM-RACE Kit (Thermo Fisher Scientific) was used according to the manufacturer's protocol. Additionally, 1 µL Super RNase inhibitor was added (1 µL to 19 µL CIP reaction). An amount of 10 µg of Hep3B total RNA was used. Various eRNA specific primers, random hexamer, or oligo d(T) were used as reverse primers. Primers: CRED9-specific Reverse Transcription Primer: 5′-CTTCAAGGAAAGGGCAAGGGTAG-3′; 5′ RACE Adapter Sequence: 5′-GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA-3′; Outer Adapter Sequence Primer: 5′-GCTGATGGCGATGAATGAACACTG-3′; Outer eRNA specific primer 3: 5′-TAGCCTCCTGGAGCGATTTA-3′; Inner Adapter Sequence Primer: 5′-CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG-3′; Inner eRNA Specific Reverse Primer 3: 5′-TCTGAAGGCACTGTGGTCTG-3′. PCR was performed using Phusion High-Fidelity Polymerase (NEB) according to manufacturer's protocol. PCR products were excised from gel and purified using a NucleoSpin Gel and PCR Clean-Up kit (Machery-Nagel). Cloning was performed using Zero Blunt PCR Cloning Kit #K270020 (Thermo Fisher). Plasmids from selected colonies were amplified in DH10b E. coli and purified by NucleoSpin Plasmid Mini kit for plasmid DNA 740588.50 (Machery-Nagel). Sequencing was performed by Eurofins Scientific. Alignment of sequenced clones was performed using Snapgene software (GSL Biotech LLC).

The pGEM-3zf+ vector (Promega # P2271) was modified for the development of a versatile toehold cloning vector. Initially the T7 terminator sequence (TAGCATAA CCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGA) was cloned with PstI (Enzyquest, Heraklion, Greece #RE028S) and HindIII (Enzyquest, Heraklion, Greece #RE016S). Next, the enhanced GFP (EGFP) sequence (Addgene plasmid #176015) was amplified with proofreading Q5 polymerase (NEB M0491S) and subsequently cloned to the T7-term modified pGEM vector with HincII (NEB #R0103S). EGFP sequence was base-to-base confirmed with Sanger sequencing (CeMIA SA, Larissa, Greece) using the T7 promoter to provide the pGEM-T7-EGFP vector. All plasmid isolations were performed with the nucleospin plasmid mini kit (Macherey Nagel #740588.50) according to manufacturer protocol, or with homemade alkaline lysis protocols.