Real-time PCR calculated hepatic TNF-alpha, IL-1, α-SMA, and TGF-β mRNA. Total RNA was isolated from hepatic tissues using RNX Plus (Sinaclon, Tehran, Iran) and cDNA was generated on the basis of the manufacturer's technique from total RNA by cDNA Synthesis kit (Sinaclon, Tehran, Iran). RT-PCR was conducted using the instrument Rotor Gene 3000 (Bio-Rad, USA). The mRNA values of TNF-α, IL-1, α-SMA, and TGF-β were standardized to GAPDH. The PCR was completed in 40 cycles: TNF-α and IL-1 at 95°C for 15 seconds, 58°C for 30 seconds, and 72°C for 30 seconds, α-SMA at 95°C for 15 seconds, 63°C for 30 seconds, and 63°C for 30 seconds, and TGF-β at 95°C for 15 seconds, 55°C for 30 seconds, 72°C for 30 seconds. Data of TNF-α, IL-1, α-SMA, and TGF-β were calculated relative to GAPDH using the 2–ΔCt method.
Rotor gene 3000
Manufactured by Bio-Rad
Sourced in United States
The Rotor Gene 3000 is a real-time PCR thermal cycler designed for nucleic acid amplification and detection. It features a rotor-based design with 36 or 72 sample positions and provides precise temperature control for efficient and reliable PCR reactions.
Automatically generated - may contain errors
Lab products found in correlation
Cdna synthesis kit, by Sinaclon (4 mentions)
Rnx plus, by Sinaclon (2 mentions)
Ssofast evagreen, by Bio-Rad (2 mentions)
High capacity reverse transcription kit, by Thermo Fisher Scientific (2 mentions)
Trizol, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Elisa reader, by Agilent Technologies (1 mentions)
Rnx plus kit, by Sinaclon (1 mentions)
7 protocols using rotor gene 3000
1
Hepatic Gene Expression Quantification
2
Quantifying Inflammatory and Fibrosis Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time PCR was implemented to assess the expression levels of inflammatory cytokines (IL-1 and TNF-α), liver fibrosis markers (TGF-β and SM-α), and the housekeeping gene internal control (β-actin). Using the TRIzol reagent (Invitrogen, Carlsbad, CA), total RNA extraction was performed which was then reverse transcribed into cDNA using Sinaclon (Tehran, Iran). In order to quantify the expression of the target genes, synthesized cDNA was then subjected to real-time PCR on a Rotor Gene 3000 (Bio-Rad, USA); primers' sequences used in this study are listed in Table 1 . The relative expression of each gene was calculated using the 2–ΔCt method.
3
Hepatic Gene Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was separated from hepatic tissues utilizing RNX Plus (Sinaclon, Tehran, Iran) and cDNA was produced from total RNA by cDNA Synthesis kit (Sinaclon, Tehran, Iran) based on the manufacturer's procedure. RT-PCR was done by Rotor Gene 3000 instrument (Bio-Rad, USA), and data of TNF-α, α–SMA, IL-1, and TGF-β were determined in comparison to GAPDH using the 2–ΔCt procedure.
4
Quantifying Hedgehog Pathway Transcripts in Liver
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from liver tissues with TRIzol (Life Technologies). cDNA was generated from total RNA with high capacity reverse transcription kits (Life Technologies). The abundance of transcripts was assessed by quantitative real-time PCR (qPCR) on a Corbett Rotor-Gene 3000 with SsoFast EvaGreen (Bio-Rad). The level of each transcript was determined by a standard curve. Expression of SHH, GLI1 and GLI3 was normalised for the efficiency of amplification with both PPIA and ACTB. The sequences of primer pairs used in qPCR were PPIA sense GGCAAATGCTGGACCCAACACA and PPIA antisense CTAGGCATGGGAGGGAACAAGG ; ACTB sense ATTGGCAATGAGCGGTTC and ACTB antisense GGATGCCACAGGACTCCAT ; SHH sense AGTTTCACTCCTGGCCACTG and SHH antisense GATGAAGAAAACACCGGAGC ; GLI1 sense TAGCTACTGATTGGTGGTGGG and GLI1 antisense ACTCCAGCCCTGGACCG ; GLI3 sense GGCTGCATAGTGATTGCGT and GLI3 antisense CGAACAGATGTGAGCGAGAA .
5
Quantification of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from liver tissues or cells with TRIzol (Life technologies, NY, USA). The complementary DNA (cDNA) was generated from total RNA with high capacity reverse transcription kits (Life Technologies) and also no template controls were made by omitting reverse transcriptase. The abundance of transcripts was assessed by quantitative real-time PCR (qPCR) on a Corbett Rotor-Gene 3000 with SsoFast EvaGreen (Bio-Rad, Hercules, CA, USA). The level of each transcript was determined by a standard curve. The expression data for each of interested genes was normalized for the efficiency of amplification with a set of reference genes, i.e. cyclophilin A, HPRT and RPL13A. PCR primers were synthesized by Sigma–Aldrich and listed in the supplementary data (Supplementary Table 1 ).
6
Quantification of TNF-α in Tissue Homogenate
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the quantitative determination of TNF-α level in tissue homogenate, a commercial kit (Kermania pars Gene, Kerman, Iran) was used based on the manufacturer's procedure. Absorption was measured via an ELISA reader (BioTek; Winooski, Vermont, USA) at 450 nm. To investigate gene expression, the total RNA was obtained from tissue homogenate by the RNX Plus kit (Sinaclon, Tehran, Iran) according to the manufacturer's instructions. Then, first-strand complementary DNA (cDNA) was produced using cDNA Synthesis kit (Sinaclon, Tehran, Iran), and Real-time PCR was performed using a RotorGene 3000 instrument (Bio-Rad, USA). PCR program was run as follows: denaturation stage at 95 °C for 15 s, annealing stage at 62 °C for 30 s, and elongation stage at 72 °C for 30 s in 40 cycles. The relative gene expression was determined by the 2−ΔΔCt formula. HPRT1 was used as the reference housekeeping gene and the findings were presented as the fold changes relative to the control group.
7
Quantification of Hepatic Cytokine mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Real-time polymerase chain reaction (RT-PCR) calculated liver IL-1, TNF-alpha, TGF-β and, α-SMA mRNA. Total RNA was isolated and cDNA was generated by total RNA and cDNA Synthesis kit (Sinaclon, Tehran, Iran). RT-PCR was done by the instrument Rotor Gene 3000 (Bio-Rad, USA). The PCR was completed in 40 cycles. Data of IL-1, TNF-alpha, TGF-β and, α-SMA were determined relative to GAPDH utilizing the 2–ΔCt formula.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!