Amv reverse transcription system

Total RNA was extracted from the collected BALF using an RNA extraction kit (BioTeke, Beijing, China) as per the manufacturer’s protocol. The RNA was then reverse-transcribed into a single-stranded cDNA using the AMV Reverse Transcription System (Takara, Dalian, Liaoning, China). Then, cDNA was amplified with SYBR Green dye kit and gene-specific primer (Takara, Shiga, Japan). The data were normalized to β-actin mRNA levels. Relative gene expression was measured by 2^−ΔΔCt method. Primer sequence design is as follows:

EZH2 (F): AGTTCGTGCCCTTGTGTGATAGC

EZH2 (R): ACTCTCGGACAGCCAGGTAGC

β-actin (F): GGCCAACCGCGAGAAGATGAC

β-actin (R): GGATAGCACAGCCTGGATAGCAAC.

Total RNA of cancer cell line were extracted from Trizol reagents (Invitrogen#15596018) according to the manufacturer’s instructions. cDNA was obtained by AMV reverse transcription system (TAKARA#2621) followed the manufacturer’s protocol. Quantitative real-time PCR was performed with SYBR Green PCR master mix reagent (ABI#4472908) and specific primers for SMAD7-F/R (ATGCTGTGCCTTCCTCCGCTG/CCACGCACCAGTGTGACCGA) and ARHGAP5-AS1-F/R (GGCCCCTGATTCAGTACGTT/GCGTGAACAGGGGTCTTTTG). Data analysis of ARHGAP5-AS1 expression in breast cancer cell lines was normalized by internal control 28S RNA and evaluated using 2^∆∆Ct method, while data analysis of breast cancer tissues was normalized by 18S RNA and presented by − ∆Ct.

Viral RNA was extracted from purified GCRV-GZ1208 using Trizol^® Reagent (see above) and full-length amplification of cDNA (FLAC) was used to amplify the entire genome of GZ1208 as described previously [41 (link)]. In brief, an anchor primer (5′-p-GACCTCTGAGGATTCTAAAC/iSp9/TCCAGTTTAGAATCC-OH-3′) possessed a C9 spacer between two complementary halves and a phosphorylated 5′ terminus. The anchor primer was ligated to the 3′ ends of the dsRNA segments using T4 RNA ligase (Takara, Tokyo, Japan). Then, the reaction mixtures were purified using a commercial RNA clean up kit (Qiagen, Hilden, Germany) and used as templates for first-strand cDNA synthesis using an AMV Reverse Transcription System (Takara, Dalian, China) and PCR amplification using a complementary primer (5′-GAGGGATCCAGTTTAGAATCCTCAGAGGTC-3′). PCR products were separated on a 1.2% agarose gel, and visible bands were purified using a Silica Bead DNA Gel Extraction kit (Fermentas, Waltham, MA, USA) and cloned into a pMD18-T vector (Takara, Dalian, China). Positive clones were sent to Sangon Biotech (Shanghai, China) for sequence analysis.