Mcf10a cells

MCF10A cells (CRL 10317), a non-tumorigenic mammary epithelial cell line, and the derived isogenic line with CDH1 knockout (MCF10A-CDH1^−/−) were purchased from Sigma (#CLLS1042). The MCF10A isogenic lines were cultured in DMEM/F12: (1:1) (Invitrogen, Carlsbad, CA, USA) with 5% horse serum (Invitrogen), 10 μg/mL Actrapid neutral insulin (Novo Nordisk Pharmaceuticals Ltd. Bagsværd, Denmark), 20 ng/mL human epidermal growth factor (Peprotech, Rehovot, Israel), 100 ng/mL cholera toxin, and 500 ng/mL hydrocortisone (Sigma Aldrich, St Louis, MO, USA). NCI-N87 gastric cancer cells (CRL-5822) were purchased from ATCC and CDH1 knockouts were generated via Crispr-Cas9 (manuscript in preparation). Briefly, the NCI-N87-CDH1^−/− cell line was generated using the following CRISPR guide RNA sequence: 5′ GCTTCATTCACATCCAGCACATCCACGGTGAC 3′ which targeted exon 10 of the CDH1 gene. This gave rise to a single nucleotide frameshift deletion followed by a T/A SNP in the CDH1 gene, which was confirmed by Sanger sequencing. The NCI-N87 isogenic lines were cultured in DMEM/F12 (1:1) (Invitrogen) with 10% fetal bovine serum (Invitrogen). All cells were grown at 37 °C with 5% CO₂.

MCF10A cells (CRL 10317), a non-tumorigenic mammary epithelial cell line, and the derived isogenic line with CDH1 knockout (MCF10A-CDH1^−/−) (#CLLS1042) were purchased from Sigma Aldrich (St. Louis, MO, USA). The MCF10A isogenic lines were cultured in DMEM/F12: (1:1) (Invitrogen, Carlsbad, CA, USA) with 5% horse serum (Invitrogen), 10 μg/mL Actrapid neutral insulin (Novo Nordisk Pharmaceuticals Ltd. Gatwick, West Sussex, UK), 20 ng/mL human epidermal growth factor (Peprotech, Rehovot, Israel), 100 ng/mL cholera toxin and 500 ng/mL hydrocortisone (Sigma Aldrich, St. Louis, MO, USA).