For CRISPRi, the KRAB-dCas9-P2A-mCherry (Addgene # 60954) plasmid was delivered into Huh7.5 cells through lentivirus infection. And the mCherry-positive cells were enriched by FACS 3 days after infection. Then the sgRNAs targeting the negatively selected lncRNAs were delivered into cells with stable expressing of dCas9-KRAB by lentivirus infection followed by cell proliferation assay and cell lethality assay. For CRISPRa, the three plasmids dCAS-VP64_Blast (Addgene # 61425), MS2-P65-HSF1_Hygro (Addgene # 61426) and sgRNAs carrying EGFP for each positively selected lncRNAs were delivered into cells through transient transfection. Then the EGFP-positive cells were enriched by FACS 3 days after transfection followed by cell lethality assay.
Krab dcas9 p2a mcherry
Manufactured by Addgene
The KRAB-dCas9-P2A-mCherry is a molecular biology tool that combines a KRAB (Krüppel-associated box) domain, a catalytically inactive Cas9 (dCas9) protein, and an mCherry fluorescent reporter. This construct can be used for targeted gene repression and visualization of the expression system.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using krab dcas9 p2a mcherry
1
Functional Screening of lncRNAs Using CRISPRi/a
2
TRIM26 Knockdown via CRISPRi in Huh7 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following three sgRNA sequences were used for the TRIM26 knockdown via CRISPRi (43 (link)) (sg1: GCGGCACCCCTCCTCTCTCA; sg2: GGAATAGCCGGGAGATTACG; sg3: GCTCGTGCAGGAGCGGGACC). The sgRNA targeting AAVS1 transcription start site (TSS) region was used as control (AAVS1 sg: CGGAACCTGAAGGAGGCGGC). The sgRNAs were cloned into a lentiviral vector expressing GFP and later packaged into VSV-G pseudotyped lentiviral particles by cotransfection with pCMVR8.74 and pVSV-G plasmids into HEK293T cells. Meanwhile, the KRAB-dCas9-P2A-mCherry (Addgene, #60954) vector was also packaged by cotransfection with pCMVR8.74 and pVSV-G plasmids. Huh7 cells were then transduced with both pseudotyped lentiviral vectors that express sgRNA and KRAB-dCas9-P2A-mCherry. Three days after transduction, the GFP and mCherry double-positive cells were sorted by FACS and further cultured. The knockdown efficiency of TRIM26 was measured by Western blot.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!